Incidental Mutation 'R4022:Sall3'
ID313326
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
MMRRC Submission 040956-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4022 (G1)
Quality Score165
Status Validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80969840 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1127 (E1127V)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: E1127V

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: E1127V

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Meta Mutation Damage Score 0.3352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abo T A 2: 26,843,800 Y131F probably damaging Het
Adcy4 C T 14: 55,775,178 probably null Het
Ago3 T A 4: 126,368,593 N388I probably benign Het
Arfgef2 G T 2: 166,873,945 V1385L probably benign Het
Camk2a A T 18: 60,963,928 K28* probably null Het
Ccdc180 T A 4: 45,904,560 Y385* probably null Het
Cd209g A T 8: 4,135,955 Q46L possibly damaging Het
Cdh22 T C 2: 165,157,253 T220A probably benign Het
Cltc A T 11: 86,720,348 C562S probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Cyp2d34 A G 15: 82,618,608 V139A probably benign Het
D17Wsu92e T C 17: 27,786,262 E107G probably damaging Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dhx30 T C 9: 110,084,397 D1223G possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Erbb2 T G 11: 98,435,297 C966W probably benign Het
Exoc1 C T 5: 76,549,570 T405I possibly damaging Het
Fbxo28 T C 1: 182,329,910 N108S possibly damaging Het
Fhdc1 T C 3: 84,445,102 E157G probably benign Het
Gstcd C T 3: 133,082,068 V290M probably damaging Het
Hps3 A G 3: 20,035,261 V2A possibly damaging Het
Itsn2 G A 12: 4,624,927 R23H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lax1 C T 1: 133,683,036 G105S probably benign Het
Lin7c G T 2: 109,896,445 probably null Het
Lrrn2 T C 1: 132,939,114 V639A probably benign Het
Luzp1 T C 4: 136,542,193 S576P probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mast4 G T 13: 102,853,869 A48E probably damaging Het
Mat2a G A 6: 72,436,244 R168C probably damaging Het
Megf8 T C 7: 25,337,775 V700A probably damaging Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Myh2 G T 11: 67,179,404 E421* probably null Het
Olfr102 T A 17: 37,314,274 I37L probably benign Het
Olfr181 T C 16: 58,926,120 I150M possibly damaging Het
Pecam1 T C 11: 106,655,160 N693D probably benign Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prune2 A G 19: 17,000,020 T40A probably damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Reln T C 5: 22,227,630 Q124R probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sertad3 A G 7: 27,476,695 N185D probably damaging Het
Sox1 A G 8: 12,396,719 Y120C probably damaging Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Spg20 G T 3: 55,117,736 V251L probably damaging Het
Stard9 A G 2: 120,704,155 E3631G probably benign Het
Syde2 A G 3: 146,015,725 T848A probably benign Het
Tmem11 T C 11: 60,865,328 D12G possibly damaging Het
Trim28 T C 7: 13,028,558 probably benign Het
Tsen2 T A 6: 115,547,987 V49E probably damaging Het
Tspan1 C T 4: 116,167,035 M10I probably benign Het
Uncx A T 5: 139,546,689 T170S probably damaging Het
Usp24 T C 4: 106,379,224 probably benign Het
Vmn1r84 T C 7: 12,361,930 I267V probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 80973450 missense probably benign 0.01
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5274:Sall3 UTSW 18 80969837 missense probably benign 0.15
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7496:Sall3 UTSW 18 80973364 missense probably benign 0.07
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R7809:Sall3 UTSW 18 80974360 missense probably benign 0.00
R8244:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8245:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8250:Sall3 UTSW 18 80973528 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8360:Sall3 UTSW 18 80974017 missense probably benign 0.31
R8410:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8476:Sall3 UTSW 18 80972118 nonsense probably null
R8712:Sall3 UTSW 18 80974021 missense not run
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCTCCGCCTAGACTTACTG -3'
(R):5'- TAACTGCGTTCTGCTGACCC -3'

Sequencing Primer
(F):5'- CTAGACTTACTGGGAGCTGAGG -3'
(R):5'- TCTGCTGACCCCAGACTAATACTTAG -3'
Posted On2015-04-30