Mutagenetix > Incidental Mutations

Incidental Mutation 'R6256:Sall3'

506153

Institutional Source

Beutler Lab

Gene Symbol

Sall3

Ensembl Gene

ENSMUSG00000024565

Gene Name

spalt like transcription factor 3

Synonyms

Msal, Spalt, Msal-1, Salt, B130022O04Rik

MMRRC Submission

044373-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6256 (G1)

Quality Score

118.008

Status

Validated

Chromosome

Chromosomal Location

80966376-80986578 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 80969861 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1120 (R1120H)

Ref Sequence

ENSEMBL: ENSMUSP00000056967 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057950]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057950
AA Change: R1120H

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: R1120H

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
low complexity region	143	161	N/A	INTRINSIC
low complexity region	189	206	N/A	INTRINSIC
low complexity region	210	231	N/A	INTRINSIC
low complexity region	271	289	N/A	INTRINSIC
low complexity region	323	342	N/A	INTRINSIC
low complexity region	350	371	N/A	INTRINSIC
ZnF_C2H2	427	449	2.57e-3	SMART
ZnF_C2H2	455	477	3.21e-4	SMART
low complexity region	555	568	N/A	INTRINSIC
ZnF_C2H2	692	714	3.99e0	SMART
ZnF_C2H2	720	742	2.99e-4	SMART
ZnF_C2H2	752	774	1.6e-4	SMART
low complexity region	834	852	N/A	INTRINSIC
low complexity region	901	923	N/A	INTRINSIC
low complexity region	993	1007	N/A	INTRINSIC
ZnF_C2H2	1061	1083	1.69e-3	SMART
ZnF_C2H2	1089	1111	5.99e-4	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	T	8: 72,451,428	Q361L	probably damaging	Het
Abca7	A	G	10: 80,002,622	T577A	probably damaging	Het
Acad12	A	T	5: 121,614,086	V54E	probably benign	Het
Ago4	A	G	4: 126,520,226	Y91H	probably damaging	Het
Akr1b10	T	C	6: 34,387,688	V28A	probably damaging	Het
Ccdc33	T	A	9: 58,101,918		probably null	Het
Ccdc7a	T	C	8: 128,935,593		probably null	Het
Ces1f	A	T	8: 93,265,794	V343E	probably damaging	Het
Cftr	T	C	6: 18,274,661	L896P	probably damaging	Het
Csmd3	G	A	15: 47,669,729	P2375S	probably damaging	Het
Dnajb14	G	C	3: 137,908,362	A345P	probably damaging	Het
Dnajb14	C	T	3: 137,908,363	A345V	probably damaging	Het
Dnase1	G	A	16: 4,037,621	R24K	probably benign	Het
Dnmbp	C	T	19: 43,852,281	V560M	probably damaging	Het
Dopey2	T	A	16: 93,807,214	I1981N	possibly damaging	Het
Eif3a	A	C	19: 60,771,026	S770A	possibly damaging	Het
Fbxl7	A	T	15: 26,553,002	C60S	probably benign	Het
Fras1	A	T	5: 96,733,843	D2478V	possibly damaging	Het
Hrnr	A	G	3: 93,322,611	D52G	probably damaging	Het
Jmjd1c	T	A	10: 67,220,408	L823M	probably damaging	Het
Kdm1a	G	T	4: 136,568,600	C172*	probably null	Het
Kdm6b	C	T	11: 69,406,729	E295K	probably damaging	Het
Mepe	A	T	5: 104,337,074	M27L	probably benign	Het
Mogat2	A	T	7: 99,219,895	H305Q	probably damaging	Het
Mst1r	T	A	9: 107,917,266	Y1215N	probably damaging	Het
Muc5ac	A	T	7: 141,789,795	H48L	possibly damaging	Het
Myo7b	T	C	18: 31,983,695	D953G	probably damaging	Het
Ocel1	T	C	8: 71,371,828		probably benign	Het
Pcdhb6	A	G	18: 37,335,925	D633G	probably damaging	Het
Ppm1l	A	G	3: 69,497,897	I176V	probably benign	Het
Sbf1	G	A	15: 89,300,867	P1018S	probably benign	Het
Setbp1	T	C	18: 78,857,257	Y1065C	probably damaging	Het
Slc25a2	T	C	18: 37,637,723		probably null	Het
Slc4a2	C	A	5: 24,435,890	T729K	probably damaging	Het
Sptlc2	T	C	12: 87,355,531	E207G	probably damaging	Het
Sult6b1	A	T	17: 78,906,914	F27I	probably benign	Het
Syf2	A	T	4: 134,934,578	K84N	probably damaging	Het
Tmem209	A	T	6: 30,497,167	N183K	probably benign	Het
Tmem232	G	T	17: 65,478,402	Q188K	possibly damaging	Het
Tomm70a	A	T	16: 57,152,692	T598S	probably benign	Het
Ttll13	A	G	7: 80,258,304	T556A	probably benign	Het
Vmn2r120	A	T	17: 57,524,700	L363*	probably null	Het
Xpo6	G	T	7: 126,108,619	Q872K	probably damaging	Het
Xrra1	A	C	7: 99,914,464	S553R	probably damaging	Het
Zfy1	A	T	Y: 738,765	V147E	unknown	Homo
Zfy2	T	C	Y: 2,116,267	I258V	probably benign	Homo

Other mutations in Sall3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Sall3	APN	18	80973232	missense	probably damaging	0.98
IGL01630:Sall3	APN	18	80971269	missense	probably benign	0.03
IGL01713:Sall3	APN	18	80969847	missense	probably damaging	1.00
IGL01803:Sall3	APN	18	80969832	missense	possibly damaging	0.65
IGL02627:Sall3	APN	18	80972361	missense	possibly damaging	0.86
IGL02858:Sall3	APN	18	80969513	missense	probably damaging	1.00
IGL03177:Sall3	APN	18	80972968	missense	probably benign	0.00
fountain	UTSW	18	80974476	missense	probably damaging	0.99
IGL02984:Sall3	UTSW	18	80973450	missense	probably benign	0.01
R1055:Sall3	UTSW	18	80969792	missense	probably benign	0.24
R1258:Sall3	UTSW	18	80974065	missense	probably damaging	1.00
R1932:Sall3	UTSW	18	80969753	missense	probably benign	0.44
R1976:Sall3	UTSW	18	80971893	missense	probably benign	0.42
R2124:Sall3	UTSW	18	80971797	missense	probably benign	0.01
R2142:Sall3	UTSW	18	80969831	missense	probably damaging	0.98
R2199:Sall3	UTSW	18	80971870	missense	probably benign	0.27
R2365:Sall3	UTSW	18	80971792	missense	probably benign	0.01
R3856:Sall3	UTSW	18	80972502	missense	probably damaging	1.00
R4022:Sall3	UTSW	18	80969840	missense	probably benign	0.05
R4050:Sall3	UTSW	18	80971482	missense	probably benign	0.03
R4085:Sall3	UTSW	18	80972133	missense	probably damaging	0.99
R4764:Sall3	UTSW	18	80974476	missense	probably damaging	0.99
R4874:Sall3	UTSW	18	80973973	missense	probably benign	0.33
R4948:Sall3	UTSW	18	80971411	missense	probably benign	0.20
R5274:Sall3	UTSW	18	80969837	missense	probably benign	0.15
R5602:Sall3	UTSW	18	80972812	missense	probably benign
R6063:Sall3	UTSW	18	80974255	missense	possibly damaging	0.52
R6431:Sall3	UTSW	18	80973187	missense	possibly damaging	0.94
R6523:Sall3	UTSW	18	80973188	missense	possibly damaging	0.68
R6719:Sall3	UTSW	18	80971506	missense	probably damaging	0.99
R6861:Sall3	UTSW	18	80974375	nonsense	probably null
R7078:Sall3	UTSW	18	80974099	missense	probably damaging	0.97
R7107:Sall3	UTSW	18	80973754	missense	probably benign	0.01
R7108:Sall3	UTSW	18	80973754	missense	probably benign	0.01
R7453:Sall3	UTSW	18	80972040	missense	probably benign	0.07
R7491:Sall3	UTSW	18	80972705	missense	probably benign	0.03
R7496:Sall3	UTSW	18	80973364	missense	probably benign	0.07
R7584:Sall3	UTSW	18	80974530	missense	probably benign	0.00
R7599:Sall3	UTSW	18	80972052	missense	possibly damaging	0.56
R7809:Sall3	UTSW	18	80974360	missense	probably benign	0.00
R8244:Sall3	UTSW	18	80973754	missense	probably benign	0.01
R8245:Sall3	UTSW	18	80973754	missense	probably benign	0.01
R8250:Sall3	UTSW	18	80973528	missense	probably benign	0.01
R8335:Sall3	UTSW	18	80969586	missense	probably benign	0.35
R8360:Sall3	UTSW	18	80974017	missense	probably benign	0.31
R8410:Sall3	UTSW	18	80973754	missense	probably benign	0.01
Z1176:Sall3	UTSW	18	80972760	missense	probably benign	0.19
Z1177:Sall3	UTSW	18	80974276	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACTTACTGGGAGCTGAGGGATG -3'
(R):5'- GTCTAATAGAAGGTGCTCGGGG -3'

Sequencing Primer
(F):5'- GACAGAGATCTCATTGTTCTTCATGG -3'
(R):5'- GGAGTCTCCCCTAACTGCG -3'

Posted On

2018-02-28