Incidental Mutation 'R8244:Sall3'
ID640890
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8244 (G1)
Quality Score204.009
Status Validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80973754 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 320 (P320S)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: P320S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: P320S

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,579 I133T probably damaging Het
Ahnak C T 19: 9,015,673 P4774S probably benign Het
Alg5 A G 3: 54,738,800 I29V probably benign Het
Ankar A G 1: 72,651,024 I1216T probably benign Het
Ap5z1 A T 5: 142,473,980 T462S possibly damaging Het
Apc2 A T 10: 80,315,332 R2073S probably damaging Het
Apob A T 12: 8,010,548 E3010V probably damaging Het
Arid3c T G 4: 41,729,997 E66A possibly damaging Het
Atf7 A G 15: 102,528,866 S54P unknown Het
Cbx3 C T 6: 51,475,370 T55I probably benign Het
Clptm1 A T 7: 19,638,991 F205I possibly damaging Het
Cramp1l T A 17: 24,971,410 I1117F probably damaging Het
Dgkq A G 5: 108,648,712 *935Q probably null Het
Dock2 A T 11: 34,695,453 F511I probably damaging Het
Efr3a G A 15: 65,815,368 R15H probably damaging Het
Ehmt2 A G 17: 34,905,262 D385G probably damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gfpt1 T A 6: 87,063,631 probably benign Het
Gm13103 T C 4: 143,853,284 Y480H probably damaging Het
Gm21680 T C 5: 25,968,985 E207G probably damaging Het
Igsf23 A T 7: 19,941,873 C141S possibly damaging Het
Ktn1 A T 14: 47,674,823 E349V probably null Het
Lrp1b T C 2: 41,506,782 D424G Het
Lrrc9 A G 12: 72,499,610 I1190V probably benign Het
Lztfl1 T A 9: 123,712,449 I102F probably damaging Het
Mapk11 G T 15: 89,145,804 T203K possibly damaging Het
Mgam T A 6: 40,750,586 I1315N probably damaging Het
Nf1 T C 11: 79,440,924 M695T probably benign Het
Pdcd4 A G 19: 53,907,534 T8A probably benign Het
Ptx4 A G 17: 25,122,865 K105E possibly damaging Het
Pxn C T 5: 115,552,243 P381L probably damaging Het
Rtn4rl1 T C 11: 75,265,450 L236P probably damaging Het
Sh2b2 G T 5: 136,227,437 S247* probably null Het
Sim2 T A 16: 94,109,363 V208E probably damaging Het
Slc44a4 T C 17: 34,921,572 L247P probably damaging Het
Sox1 GGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGG 8: 12,396,468 probably benign Het
Tacc2 A G 7: 130,728,676 D1937G probably damaging Het
Tmem131 T C 1: 36,808,893 N1158S probably benign Het
Tns1 G T 1: 73,937,251 A1146E probably damaging Het
Tom1l1 T C 11: 90,657,821 E308G probably benign Het
Ttn T A 2: 76,828,707 K12262* probably null Het
Vps13b G T 15: 35,917,203 G3731V probably damaging Het
Wdr20 G A 12: 110,793,642 E321K probably benign Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Zfp979 A T 4: 147,613,476 C259S possibly damaging Het
Zscan20 T C 4: 128,585,966 T911A probably benign Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 80973450 missense probably benign 0.01
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4022:Sall3 UTSW 18 80969840 missense probably benign 0.05
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5274:Sall3 UTSW 18 80969837 missense probably benign 0.15
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7496:Sall3 UTSW 18 80973364 missense probably benign 0.07
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R7809:Sall3 UTSW 18 80974360 missense probably benign 0.00
R8245:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8250:Sall3 UTSW 18 80973528 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8360:Sall3 UTSW 18 80974017 missense probably benign 0.31
R8410:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8476:Sall3 UTSW 18 80972118 nonsense probably null
R8712:Sall3 UTSW 18 80974021 missense not run
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGGCAGCAATGCTAACCAG -3'
(R):5'- CAGTACAGCTTCAGGGTCTG -3'

Sequencing Primer
(F):5'- TTGGGGAAGATGACACTGCTG -3'
(R):5'- GTACAGCTTCAGGGTCTGACTCC -3'
Posted On2020-07-28