Incidental Mutation 'R8537:Eif2ak1'
ID 659281
Institutional Source Beutler Lab
Gene Symbol Eif2ak1
Ensembl Gene ENSMUSG00000029613
Gene Name eukaryotic translation initiation factor 2 alpha kinase 1
Synonyms Hri
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R8537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 143817788-143904251 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 143899069 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 526 (T526K)
Ref Sequence ENSEMBL: ENSMUSP00000098056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031613] [ENSMUST00000079624] [ENSMUST00000100483] [ENSMUST00000100487] [ENSMUST00000110717] [ENSMUST00000110718]
AlphaFold Q9Z2R9
Predicted Effect probably benign
Transcript: ENSMUST00000031613
SMART Domains Protein: ENSMUSP00000031613
Gene: ENSMUSG00000029610

DomainStartEndE-ValueType
Pfam:AIMP2_LysRS_bd 1 44 8.3e-26 PFAM
low complexity region 133 142 N/A INTRINSIC
Pfam:GST_C_3 231 308 2.5e-10 PFAM
Pfam:GST_C 242 310 5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079624
SMART Domains Protein: ENSMUSP00000078571
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
ANK 36 61 2.55e2 SMART
ANK 65 118 8.5e2 SMART
ANK 124 153 1.27e-2 SMART
ANK 157 186 7.95e-4 SMART
ANK 191 230 3.74e0 SMART
ANK 234 263 3.46e-4 SMART
Blast:ANK 267 300 4e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100483
SMART Domains Protein: ENSMUSP00000098052
Gene: ENSMUSG00000029610

DomainStartEndE-ValueType
low complexity region 93 102 N/A INTRINSIC
Pfam:GST_C_3 185 268 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100487
AA Change: T526K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098056
Gene: ENSMUSG00000029613
AA Change: T526K

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 62 81 N/A INTRINSIC
Pfam:Pkinase_Tyr 167 242 5.6e-6 PFAM
Pfam:Pkinase 167 257 1.9e-15 PFAM
low complexity region 314 320 N/A INTRINSIC
Pfam:Pkinase 365 580 1.3e-31 PFAM
Pfam:Pkinase_Tyr 373 578 1.9e-19 PFAM
coiled coil region 585 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110717
SMART Domains Protein: ENSMUSP00000106345
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
Blast:ANK 28 57 6e-11 BLAST
ANK 78 103 1.6e0 SMART
ANK 107 160 5.6e0 SMART
ANK 166 195 8.4e-5 SMART
ANK 199 228 5.3e-6 SMART
ANK 233 272 2.4e-2 SMART
ANK 276 305 2.3e-6 SMART
Blast:ANK 309 342 5e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110718
SMART Domains Protein: ENSMUSP00000106346
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
ANK 35 60 2.55e2 SMART
ANK 64 117 8.5e2 SMART
ANK 123 152 1.27e-2 SMART
ANK 156 185 7.95e-4 SMART
ANK 190 229 3.74e0 SMART
ANK 233 262 3.46e-4 SMART
Blast:ANK 266 299 4e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts at the level of translation initiation to downregulate protein synthesis in response to stress. The encoded protein is a kinase that can be inactivated by hemin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit enlarged heart size and abnormal red blood cell development, morphology, and physiology with macrocytic anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,190,550 E579V probably damaging Het
Adgrv1 T A 13: 81,536,372 D1790V probably damaging Het
Avl9 T A 6: 56,728,659 Y175* probably null Het
Bmp2 A T 2: 133,561,282 D251V probably damaging Het
Camsap2 T A 1: 136,277,205 K1191N probably damaging Het
Ccdc102a A C 8: 94,906,056 F431C probably benign Het
Ccdc186 T C 19: 56,810,245 I270M probably damaging Het
Copb2 A G 9: 98,587,619 Q851R probably null Het
Cyp11b2 C T 15: 74,856,167 R22K probably benign Het
Ddx50 A G 10: 62,642,849 F186S probably damaging Het
Dhx38 T C 8: 109,553,380 Y926C probably damaging Het
Dmrt2 T C 19: 25,673,936 M162T possibly damaging Het
Dnah10 G T 5: 124,816,100 G3309V probably damaging Het
Dnajb2 T C 1: 75,239,598 F107S probably damaging Het
Dock8 T A 19: 25,130,506 S867T probably benign Het
Gm30302 A G 13: 49,786,632 V534A possibly damaging Het
Gnas T C 2: 174,298,601 S188P possibly damaging Het
Gpam T C 19: 55,096,239 D36G probably benign Het
Gucy2e C A 11: 69,236,353 R98L probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpu T C 1: 178,333,634 probably benign Het
Icos A G 1: 60,993,942 D100G probably damaging Het
Ifi203 A T 1: 173,928,906 probably benign Het
Ift46 T A 9: 44,783,983 L92Q probably damaging Het
Kcnip2 C T 19: 45,815,730 probably null Het
Lgr5 T C 10: 115,452,402 Y779C probably damaging Het
Ltk G T 2: 119,758,107 P287Q probably benign Het
Mapk8ip3 A T 17: 24,901,678 C852* probably null Het
Mmp27 A G 9: 7,579,775 M443V probably benign Het
Muc6 T C 7: 141,647,917 D769G probably benign Het
Myo7b T C 18: 31,977,089 I1107V probably benign Het
Nebl T A 2: 17,350,709 H211L probably benign Het
Oaz3 T A 3: 94,436,435 K40N probably damaging Het
Olfr1111 T A 2: 87,150,038 T208S probably benign Het
Olfr860 T A 9: 19,846,552 E22D probably damaging Het
Osbpl10 G T 9: 115,229,909 A718S probably benign Het
Ppp3ca T A 3: 136,797,858 I64K possibly damaging Het
Prlr T C 15: 10,314,180 probably benign Het
Rab3ip A G 10: 116,910,154 I424T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Sec62 G T 3: 30,818,812 R348L unknown Het
Sema5b C T 16: 35,651,609 A479V possibly damaging Het
Shank3 T C 15: 89,532,215 I222T probably damaging Het
Sp1 C T 15: 102,408,529 T154I possibly damaging Het
Srek1 A G 13: 103,752,449 probably benign Het
Tmem129 A G 5: 33,655,576 S143P possibly damaging Het
Tmem202 A T 9: 59,519,646 C194S probably benign Het
Tmprss15 A T 16: 79,087,515 I93K probably damaging Het
Ttn A G 2: 76,776,309 Y16340H probably damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Other mutations in Eif2ak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Eif2ak1 APN 5 143889470 missense probably damaging 0.99
IGL02170:Eif2ak1 APN 5 143879460 missense probably benign 0.01
IGL02472:Eif2ak1 APN 5 143884883 missense probably benign 0.00
IGL02898:Eif2ak1 APN 5 143889452 missense probably damaging 1.00
IGL03078:Eif2ak1 APN 5 143873769 missense probably benign 0.02
PIT4520001:Eif2ak1 UTSW 5 143899209 nonsense probably null
R0523:Eif2ak1 UTSW 5 143882166 missense probably damaging 1.00
R0755:Eif2ak1 UTSW 5 143884924 missense possibly damaging 0.94
R1128:Eif2ak1 UTSW 5 143899176 splice site probably null
R1203:Eif2ak1 UTSW 5 143883979 missense probably benign 0.00
R1445:Eif2ak1 UTSW 5 143873899 splice site probably benign
R1474:Eif2ak1 UTSW 5 143871967 missense probably damaging 1.00
R1972:Eif2ak1 UTSW 5 143884714 missense probably benign 0.04
R3885:Eif2ak1 UTSW 5 143884661 missense probably benign 0.21
R3889:Eif2ak1 UTSW 5 143884661 missense probably benign 0.21
R4754:Eif2ak1 UTSW 5 143901803 missense probably damaging 0.99
R4971:Eif2ak1 UTSW 5 143882168 missense probably damaging 1.00
R5007:Eif2ak1 UTSW 5 143873880 missense probably benign
R5487:Eif2ak1 UTSW 5 143897163 critical splice acceptor site probably null
R5505:Eif2ak1 UTSW 5 143817990 missense probably benign
R5808:Eif2ak1 UTSW 5 143883994 missense probably benign 0.21
R5888:Eif2ak1 UTSW 5 143886915 missense probably damaging 1.00
R6290:Eif2ak1 UTSW 5 143884799 missense probably benign 0.34
R6322:Eif2ak1 UTSW 5 143899095 missense probably benign 0.05
R6475:Eif2ak1 UTSW 5 143818010 splice site probably null
R7343:Eif2ak1 UTSW 5 143877671 missense probably damaging 1.00
R7525:Eif2ak1 UTSW 5 143886898 missense probably damaging 1.00
R7554:Eif2ak1 UTSW 5 143879478 missense probably damaging 1.00
R7659:Eif2ak1 UTSW 5 143889462 missense probably damaging 1.00
R8341:Eif2ak1 UTSW 5 143884937 missense probably benign 0.34
R8808:Eif2ak1 UTSW 5 143879446 missense probably damaging 1.00
R9062:Eif2ak1 UTSW 5 143817793 start gained probably benign
R9748:Eif2ak1 UTSW 5 143882213 missense probably damaging 0.99
X0027:Eif2ak1 UTSW 5 143879435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACCCTTCTTTGGAGATGC -3'
(R):5'- TGACTCTTGGAATCATACCCAACC -3'

Sequencing Primer
(F):5'- GAGATGCTATAAGGCCTCCTCCATG -3'
(R):5'- TGCTACATACATTTCCAGTTGTTTG -3'
Posted On 2021-01-18