Incidental Mutation 'R0735:Olfr418'
ID68199
Institutional Source Beutler Lab
Gene Symbol Olfr418
Ensembl Gene ENSMUSG00000049605
Gene Nameolfactory receptor 418
SynonymsGA_x6K02T2P20D-20826777-20827719, MOR267-8, GA_x6K02T2R7CC-581296-580364, Olfr418-ps1, Olfr1403, MOR267-12P
MMRRC Submission 038916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R0735 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173266001-173273994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173271002 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 276 (T276A)
Ref Sequence ENSEMBL: ENSMUSP00000150427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059754] [ENSMUST00000111224] [ENSMUST00000213420]
Predicted Effect probably benign
Transcript: ENSMUST00000059754
AA Change: T276A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000052418
Gene: ENSMUSG00000049605
AA Change: T276A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-55 PFAM
Pfam:7tm_1 41 289 5.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111224
SMART Domains Protein: ENSMUSP00000106855
Gene: ENSMUSG00000079180

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PTX 20 219 1.93e-94 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213420
AA Change: T276A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 91.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,638 I1552K possibly damaging Het
Actr8 T A 14: 29,989,712 M405K probably benign Het
Adam10 G A 9: 70,748,251 V334I possibly damaging Het
Adgra2 G T 8: 27,117,318 G686C probably damaging Het
Akap11 A T 14: 78,510,078 I1623N probably damaging Het
Astn1 A T 1: 158,472,389 T100S possibly damaging Het
B3galt1 A C 2: 68,118,579 I213L possibly damaging Het
B4galnt4 A G 7: 141,064,323 K101E probably benign Het
Camsap2 A G 1: 136,292,888 S324P probably damaging Het
Chrnb4 A G 9: 55,043,800 S60P probably damaging Het
Cpne1 A G 2: 156,078,750 probably null Het
Cubn G A 2: 13,491,689 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cxcl15 T C 5: 90,801,294 M106T probably benign Het
Cyp2c23 A T 19: 44,016,810 M140K probably damaging Het
Dgke A G 11: 89,060,075 F104S probably benign Het
Dhx36 T A 3: 62,472,729 M849L probably benign Het
Dnah7a C T 1: 53,544,511 E1522K possibly damaging Het
Edil3 G T 13: 89,177,178 V219F probably damaging Het
Egln1 A G 8: 124,948,495 V187A possibly damaging Het
Fam193a T C 5: 34,439,378 I455T possibly damaging Het
Fdft1 A T 14: 63,163,420 I88N probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Frs2 T A 10: 117,074,582 S292C probably damaging Het
Gm15448 T C 7: 3,821,782 T533A possibly damaging Het
Gpr107 T A 2: 31,171,994 F145I probably benign Het
Gpr153 T A 4: 152,279,373 C83* probably null Het
H2-Q7 T G 17: 35,440,186 probably null Het
Hsp90b1 A T 10: 86,695,748 probably benign Het
Kcnk1 C A 8: 126,025,289 N211K probably damaging Het
Klb T C 5: 65,379,727 V800A probably benign Het
Lat2 T C 5: 134,606,783 Y59C probably damaging Het
Mlkl A T 8: 111,327,801 probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtbp T A 15: 55,562,942 C93* probably null Het
Myo7a A G 7: 98,081,180 probably benign Het
Myt1 G A 2: 181,807,387 probably benign Het
Ogfrl1 T C 1: 23,375,754 Q224R possibly damaging Het
Olfr661 A T 7: 104,688,819 H268L probably damaging Het
Osbpl2 A G 2: 180,150,290 probably benign Het
Plb1 C T 5: 32,284,920 T252M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn T C 6: 92,189,693 T657A probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rps6kb2 C A 19: 4,157,883 S348I probably benign Het
Rsrp1 C T 4: 134,924,257 R111W unknown Het
Ryr3 T C 2: 112,732,982 T2933A probably benign Het
Scara5 A G 14: 65,731,019 D247G possibly damaging Het
Slc7a11 C T 3: 50,424,096 S231N probably benign Het
Sod2 A T 17: 13,010,564 N91Y probably damaging Het
Spesp1 A T 9: 62,272,685 S314T probably benign Het
St3gal1 C A 15: 67,113,687 M39I probably benign Het
Stat6 A T 10: 127,658,241 I646F probably damaging Het
Tdrd1 A T 19: 56,865,978 K1119* probably null Het
Thbs2 A G 17: 14,679,815 I600T probably benign Het
Tor1a A G 2: 30,963,838 V160A probably damaging Het
Trdmt1 T G 2: 13,523,438 D104A probably benign Het
Trim58 T C 11: 58,651,393 V393A probably benign Het
Trip4 C T 9: 65,884,918 probably benign Het
Trip6 T C 5: 137,310,821 E341G probably benign Het
Ttn T A 2: 76,715,195 I32595F probably damaging Het
Ubr4 T A 4: 139,428,028 probably null Het
Ush2a G A 1: 188,864,693 V3877I probably benign Het
Vmn1r29 G T 6: 58,307,732 G146C probably damaging Het
Vmn2r53 A G 7: 12,581,780 V704A probably benign Het
Vmn2r7 C T 3: 64,716,367 M268I probably benign Het
Wnt7b G A 15: 85,537,495 T248M probably damaging Het
Xab2 G A 8: 3,613,649 P394S possibly damaging Het
Zfp663 A G 2: 165,359,075 V13A probably damaging Het
Other mutations in Olfr418
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Olfr418 APN 1 173270708 missense probably damaging 1.00
IGL01418:Olfr418 APN 1 173270708 missense probably damaging 1.00
IGL01930:Olfr418 APN 1 173270610 missense probably benign
IGL01963:Olfr418 APN 1 173270352 missense probably damaging 0.99
IGL02104:Olfr418 APN 1 173271036 missense probably damaging 0.96
IGL02192:Olfr418 APN 1 173270850 missense probably damaging 1.00
IGL02256:Olfr418 APN 1 173270627 missense probably benign 0.04
IGL02340:Olfr418 APN 1 173270405 missense probably benign 0.10
IGL02454:Olfr418 APN 1 173270940 missense probably damaging 0.99
IGL02638:Olfr418 APN 1 173270331 missense probably benign 0.07
FR4737:Olfr418 UTSW 1 173270630 frame shift probably null
FR4976:Olfr418 UTSW 1 173270630 frame shift probably null
R0552:Olfr418 UTSW 1 173270805 missense probably benign 0.05
R0621:Olfr418 UTSW 1 173270675 missense possibly damaging 0.48
R1506:Olfr418 UTSW 1 173270769 missense probably benign 0.04
R1670:Olfr418 UTSW 1 173270900 missense probably damaging 1.00
R2111:Olfr418 UTSW 1 173270312 missense probably benign
R2204:Olfr418 UTSW 1 173270136 unclassified probably null
R4475:Olfr418 UTSW 1 173270913 missense probably damaging 0.99
R4909:Olfr418 UTSW 1 173270979 missense probably damaging 0.97
R5457:Olfr418 UTSW 1 173270574 missense probably benign 0.00
R6124:Olfr418 UTSW 1 173270279 missense probably damaging 1.00
R6456:Olfr418 UTSW 1 173270538 missense probably damaging 1.00
R7220:Olfr418 UTSW 1 173270244 missense possibly damaging 0.56
R7240:Olfr418 UTSW 1 173270994 missense probably benign 0.27
R7672:Olfr418 UTSW 1 173270873 missense probably benign 0.18
R8073:Olfr418 UTSW 1 173270985 missense probably benign 0.42
RF032:Olfr418 UTSW 1 173270709 frame shift probably null
RF036:Olfr418 UTSW 1 173270709 frame shift probably null
RF040:Olfr418 UTSW 1 173270709 frame shift probably null
X0019:Olfr418 UTSW 1 173270557 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATCCTCAAGATTGCCTCTGCTGA -3'
(R):5'- TGTTGTCTGCATTTTGTTCTCAAGACAC -3'

Sequencing Primer
(F):5'- ATTGCCTCTGCTGAGGGAC -3'
(R):5'- tcaatccccagcaaccac -3'
Posted On2013-09-03