Incidental Mutation 'R9038:D6Ertd527e'
ID 687531
Institutional Source Beutler Lab
Gene Symbol D6Ertd527e
Ensembl Gene ENSMUSG00000090891
Gene Name DNA segment, Chr 6, ERATO Doi 527, expressed
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock # R9038 (G1)
Quality Score 137.008
Status Not validated
Chromosome 6
Chromosomal Location 87104746-87112997 bp(+) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) A to G at 87112251 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 465 (*465W)
Ref Sequence ENSEMBL: ENSMUSP00000145529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170124] [ENSMUST00000203747] [ENSMUST00000204927]
AlphaFold A0A0N4SWI3
Predicted Effect probably null
Transcript: ENSMUST00000170124
AA Change: *464W
SMART Domains Protein: ENSMUSP00000130803
Gene: ENSMUSG00000090891
AA Change: *464W

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203747
AA Change: *464W
SMART Domains Protein: ENSMUSP00000144761
Gene: ENSMUSG00000090891
AA Change: *464W

DomainStartEndE-ValueType
low complexity region 5 182 N/A INTRINSIC
internal_repeat_1 185 206 1.04e-33 PROSPERO
low complexity region 211 242 N/A INTRINSIC
internal_repeat_2 243 253 2.12e-11 PROSPERO
internal_repeat_2 259 269 2.12e-11 PROSPERO
low complexity region 271 293 N/A INTRINSIC
internal_repeat_1 296 317 1.04e-33 PROSPERO
low complexity region 322 458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204927
AA Change: *465W
SMART Domains Protein: ENSMUSP00000145529
Gene: ENSMUSG00000090891
AA Change: *465W

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,754,500 Y371N possibly damaging Het
Abcb5 A T 12: 118,931,916 C382S probably benign Het
Abcf2 A G 5: 24,571,193 V296A possibly damaging Het
Aco2 C G 15: 81,872,419 probably benign Het
Acvrl1 A G 15: 101,141,130 D436G possibly damaging Het
Adamts7 A G 9: 90,174,639 I254V Het
Arhgef18 A G 8: 3,453,257 I888V probably benign Het
Arhgef40 C A 14: 51,997,615 A1083D probably damaging Het
Arnt2 C A 7: 84,304,851 A275S probably benign Het
Brip1 C T 11: 86,189,773 V156I probably benign Het
Camk4 C A 18: 33,158,900 C204* probably null Het
Cenpe A G 3: 135,218,036 T161A probably benign Het
Chd2 G A 7: 73,455,610 H1256Y probably damaging Het
Chd9 G A 8: 90,989,605 V936I unknown Het
Dcaf11 T A 14: 55,565,657 D309E probably damaging Het
Dtna A G 18: 23,610,496 N373S probably benign Het
Eif2b2 A G 12: 85,220,123 D104G probably benign Het
Fras1 A T 5: 96,726,883 T2302S probably benign Het
Gga1 A G 15: 78,884,121 K114E probably damaging Het
Gm12887 A G 4: 121,616,419 probably null Het
Gss A T 2: 155,564,874 I396N Het
H2-M5 T C 17: 36,988,530 I199M possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ift172 G T 5: 31,284,055 T245K possibly damaging Het
Iqck A G 7: 118,899,658 D173G probably damaging Het
Itga11 A G 9: 62,767,757 N857S possibly damaging Het
Kdm1b C A 13: 47,049,294 S68R probably benign Het
Ly6c1 C A 15: 75,045,451 G116V probably damaging Het
Myo6 G T 9: 80,255,003 V341L unknown Het
Nfkbie C A 17: 45,559,257 A176E probably damaging Het
Nlrp2 C T 7: 5,327,479 M639I probably benign Het
Olfr1090 A T 2: 86,754,010 S243T probably damaging Het
Olfr1140 A G 2: 87,746,781 N195S probably damaging Het
Olfr1512 T A 14: 52,372,259 S265C probably damaging Het
Olfr418 T A 1: 173,270,580 I135N possibly damaging Het
Olfr680-ps1 T C 7: 105,091,226 I138V probably benign Het
Olfr811 T C 10: 129,801,695 T277A probably damaging Het
Pak4 G A 7: 28,564,838 T213M probably damaging Het
Pan2 C T 10: 128,317,941 Q1003* probably null Het
Pde4c G C 8: 70,726,901 V34L probably benign Het
Pi4k2a G A 19: 42,100,796 V199M probably damaging Het
Platr25 T C 13: 62,700,193 E285G probably damaging Het
Polr3e T C 7: 120,937,683 V356A possibly damaging Het
Prcp A G 7: 92,917,809 D243G probably benign Het
Qsox2 T C 2: 26,225,234 T161A probably damaging Het
Rhoj A G 12: 75,308,926 T35A Het
Scn9a T A 2: 66,494,803 M1336L probably damaging Het
Sel1l2 G T 2: 140,275,464 N162K probably damaging Het
Slc15a3 T C 19: 10,843,502 L161P probably damaging Het
Slc4a11 G A 2: 130,691,743 A100V probably damaging Het
Sp1 A G 15: 102,407,885 S41G probably benign Het
Tbx15 A G 3: 99,314,769 M183V probably benign Het
Tfip11 A G 5: 112,333,348 T397A possibly damaging Het
Themis T C 10: 28,781,753 S259P probably damaging Het
Tm7sf2 T C 19: 6,067,142 Y77C probably damaging Het
Tnnt2 C A 1: 135,846,746 P81H possibly damaging Het
Trpc7 T C 13: 56,888,073 T16A probably benign Het
Ttc30a2 G A 2: 75,977,871 T99I probably benign Het
Ttn T A 2: 76,914,712 Y5331F possibly damaging Het
Virma A G 4: 11,526,922 Q1057R possibly damaging Het
Vmn2r118 A T 17: 55,611,649 F81Y probably damaging Het
Vmn2r88 T C 14: 51,414,033 V268A Het
Vmn2r93 T A 17: 18,304,209 M155K probably benign Het
Vps13b G T 15: 35,875,785 C2772F possibly damaging Het
Wdr90 T C 17: 25,857,226 N86D Het
Zbtb34 T C 2: 33,411,236 D431G probably damaging Het
Zc3h3 G A 15: 75,839,388 P408L probably benign Het
Zfp345 A G 2: 150,471,944 Y558H probably benign Het
Zfp583 G A 7: 6,316,544 P490S probably damaging Het
Other mutations in D6Ertd527e
AlleleSourceChrCoordTypePredicted EffectPPH Score
Bursting UTSW 6 87111317 missense unknown
R0739_D6Ertd527e_618 UTSW 6 87111668 missense unknown
sonenschein UTSW 6 87111524 missense unknown
R0325:D6Ertd527e UTSW 6 87111295 missense unknown
R0415:D6Ertd527e UTSW 6 87111524 missense unknown
R0607:D6Ertd527e UTSW 6 87111905 missense unknown
R0739:D6Ertd527e UTSW 6 87111668 missense unknown
R0992:D6Ertd527e UTSW 6 87111524 missense unknown
R0993:D6Ertd527e UTSW 6 87111524 missense unknown
R1193:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1196:D6Ertd527e UTSW 6 87111524 missense unknown
R1386:D6Ertd527e UTSW 6 87111524 missense unknown
R1413:D6Ertd527e UTSW 6 87111353 missense unknown
R1485:D6Ertd527e UTSW 6 87111085 missense unknown
R1560:D6Ertd527e UTSW 6 87111524 missense unknown
R1561:D6Ertd527e UTSW 6 87111524 missense unknown
R1568:D6Ertd527e UTSW 6 87111524 missense unknown
R2290:D6Ertd527e UTSW 6 87111545 missense unknown
R4155:D6Ertd527e UTSW 6 87111524 missense unknown
R4461:D6Ertd527e UTSW 6 87111317 missense unknown
R4836:D6Ertd527e UTSW 6 87111424 small insertion probably benign
R5102:D6Ertd527e UTSW 6 87111811 missense unknown
R5149:D6Ertd527e UTSW 6 87111524 missense unknown
R5150:D6Ertd527e UTSW 6 87111524 missense unknown
R5681:D6Ertd527e UTSW 6 87111206 missense unknown
R6250:D6Ertd527e UTSW 6 87111212 missense unknown
R6398:D6Ertd527e UTSW 6 87111524 missense unknown
R6441:D6Ertd527e UTSW 6 87111524 missense unknown
R7001:D6Ertd527e UTSW 6 87111212 missense unknown
R7142:D6Ertd527e UTSW 6 87111524 missense unknown
R7297:D6Ertd527e UTSW 6 87111524 missense unknown
R7821:D6Ertd527e UTSW 6 87110897 missense unknown
R8047:D6Ertd527e UTSW 6 87111472 missense unknown
R8827:D6Ertd527e UTSW 6 87111244 missense unknown
S24628:D6Ertd527e UTSW 6 87111524 missense unknown
V1662:D6Ertd527e UTSW 6 87111892 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCCCCAGATCTAGTAACACAG -3'
(R):5'- ACTCTGTCTGATTGCTGACTG -3'

Sequencing Primer
(F):5'- GATCTAGTAACACAGACAGCAGCAG -3'
(R):5'- CTGATTGCTGACTGGATAATTTCTAC -3'
Posted On 2021-11-19