Incidental Mutation 'R0992:D6Ertd527e'
ID 97765
Institutional Source Beutler Lab
Gene Symbol D6Ertd527e
Ensembl Gene ENSMUSG00000090891
Gene Name DNA segment, Chr 6, ERATO Doi 527, expressed
Synonyms
MMRRC Submission 039112-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock # R0992 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 87104746-87112997 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 87111524 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 223 (T223S)
Ref Sequence ENSEMBL: ENSMUSP00000145529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170124] [ENSMUST00000203747] [ENSMUST00000204927]
AlphaFold A0A0N4SWI3
Predicted Effect unknown
Transcript: ENSMUST00000170124
AA Change: T222S
SMART Domains Protein: ENSMUSP00000130803
Gene: ENSMUSG00000090891
AA Change: T222S

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203725
Predicted Effect unknown
Transcript: ENSMUST00000203747
AA Change: T222S
SMART Domains Protein: ENSMUSP00000144761
Gene: ENSMUSG00000090891
AA Change: T222S

DomainStartEndE-ValueType
low complexity region 5 182 N/A INTRINSIC
internal_repeat_1 185 206 1.04e-33 PROSPERO
low complexity region 211 242 N/A INTRINSIC
internal_repeat_2 243 253 2.12e-11 PROSPERO
internal_repeat_2 259 269 2.12e-11 PROSPERO
low complexity region 271 293 N/A INTRINSIC
internal_repeat_1 296 317 1.04e-33 PROSPERO
low complexity region 322 458 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204927
AA Change: T223S
SMART Domains Protein: ENSMUSP00000145529
Gene: ENSMUSG00000090891
AA Change: T223S

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205257
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,211,684 T905A probably damaging Het
Arhgap20 A G 9: 51,816,786 R100G probably damaging Het
Bsn G A 9: 108,114,354 R1400* probably null Het
Clstn2 A G 9: 97,445,712 S948P probably benign Het
Col15a1 G A 4: 47,300,491 V1029M probably damaging Het
Disc1 T C 8: 125,088,042 I215T probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dst A G 1: 34,199,536 N3773S probably damaging Het
Gdap1 A G 1: 17,147,105 Y96C probably damaging Het
Glipr1l1 A G 10: 112,062,325 R112G probably benign Het
Gria4 A G 9: 4,795,238 S13P probably benign Het
Noxred1 T C 12: 87,224,226 N207S probably benign Het
Pom121l2 A T 13: 21,982,759 Q400L probably benign Het
Sla2 T C 2: 156,874,472 E243G probably damaging Het
Srpk2 A G 5: 23,545,543 I54T probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Trim15 C T 17: 36,865,011 V215M probably damaging Het
Uchl3 T C 14: 101,668,533 I144T probably benign Het
Other mutations in D6Ertd527e
AlleleSourceChrCoordTypePredicted EffectPPH Score
Bursting UTSW 6 87111317 missense unknown
R0739_D6Ertd527e_618 UTSW 6 87111668 missense unknown
sonenschein UTSW 6 87111524 missense unknown
R0325:D6Ertd527e UTSW 6 87111295 missense unknown
R0415:D6Ertd527e UTSW 6 87111524 missense unknown
R0607:D6Ertd527e UTSW 6 87111905 missense unknown
R0739:D6Ertd527e UTSW 6 87111668 missense unknown
R0993:D6Ertd527e UTSW 6 87111524 missense unknown
R1193:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1196:D6Ertd527e UTSW 6 87111524 missense unknown
R1386:D6Ertd527e UTSW 6 87111524 missense unknown
R1413:D6Ertd527e UTSW 6 87111353 missense unknown
R1485:D6Ertd527e UTSW 6 87111085 missense unknown
R1560:D6Ertd527e UTSW 6 87111524 missense unknown
R1561:D6Ertd527e UTSW 6 87111524 missense unknown
R1568:D6Ertd527e UTSW 6 87111524 missense unknown
R2290:D6Ertd527e UTSW 6 87111545 missense unknown
R4155:D6Ertd527e UTSW 6 87111524 missense unknown
R4461:D6Ertd527e UTSW 6 87111317 missense unknown
R4836:D6Ertd527e UTSW 6 87111424 small insertion probably benign
R5102:D6Ertd527e UTSW 6 87111811 missense unknown
R5149:D6Ertd527e UTSW 6 87111524 missense unknown
R5150:D6Ertd527e UTSW 6 87111524 missense unknown
R5681:D6Ertd527e UTSW 6 87111206 missense unknown
R6250:D6Ertd527e UTSW 6 87111212 missense unknown
R6398:D6Ertd527e UTSW 6 87111524 missense unknown
R6441:D6Ertd527e UTSW 6 87111524 missense unknown
R7001:D6Ertd527e UTSW 6 87111212 missense unknown
R7142:D6Ertd527e UTSW 6 87111524 missense unknown
R7297:D6Ertd527e UTSW 6 87111524 missense unknown
R7821:D6Ertd527e UTSW 6 87110897 missense unknown
R8047:D6Ertd527e UTSW 6 87111472 missense unknown
R8827:D6Ertd527e UTSW 6 87111244 missense unknown
R9038:D6Ertd527e UTSW 6 87112251 makesense probably null
S24628:D6Ertd527e UTSW 6 87111524 missense unknown
V1662:D6Ertd527e UTSW 6 87111892 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCATCAGACCTAGTAACAGGGGC -3'
(R):5'- GCTGCTGCTACTGCTGCTGC -3'

Sequencing Primer
(F):5'- gcagcatcagcaactatgac -3'
(R):5'- tactgctgctgctgctg -3'
Posted On 2014-01-05