Mutagenetix > Incidental Mutation

Incidental Mutation 'R9038:Tbx15'

687523

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.935) question?

Stock #

R9038 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 99314769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 183 (M183V)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

probably benign
Transcript: ENSMUST00000029462
AA Change: M183V

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: M183V

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150756
AA Change: M77V

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868
AA Change: M77V

Domain	Start	End	E-Value	Type
TBOX	6	142	2.4e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	T	19: 29,754,500	Y371N	possibly damaging	Het
Abcb5	A	T	12: 118,931,916	C382S	probably benign	Het
Abcf2	A	G	5: 24,571,193	V296A	possibly damaging	Het
Aco2	C	G	15: 81,872,419		probably benign	Het
Acvrl1	A	G	15: 101,141,130	D436G	possibly damaging	Het
Adamts7	A	G	9: 90,174,639	I254V		Het
Arhgef18	A	G	8: 3,453,257	I888V	probably benign	Het
Arhgef40	C	A	14: 51,997,615	A1083D	probably damaging	Het
Arnt2	C	A	7: 84,304,851	A275S	probably benign	Het
Brip1	C	T	11: 86,189,773	V156I	probably benign	Het
Camk4	C	A	18: 33,158,900	C204*	probably null	Het
Cenpe	A	G	3: 135,218,036	T161A	probably benign	Het
Chd2	G	A	7: 73,455,610	H1256Y	probably damaging	Het
Chd9	G	A	8: 90,989,605	V936I	unknown	Het
D6Ertd527e	A	G	6: 87,112,251	*465W	probably null	Het
Dcaf11	T	A	14: 55,565,657	D309E	probably damaging	Het
Dtna	A	G	18: 23,610,496	N373S	probably benign	Het
Eif2b2	A	G	12: 85,220,123	D104G	probably benign	Het
Fras1	A	T	5: 96,726,883	T2302S	probably benign	Het
Gga1	A	G	15: 78,884,121	K114E	probably damaging	Het
Gm12887	A	G	4: 121,616,419		probably null	Het
Gss	A	T	2: 155,564,874	I396N		Het
H2-M5	T	C	17: 36,988,530	I199M	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Ift172	G	T	5: 31,284,055	T245K	possibly damaging	Het
Iqck	A	G	7: 118,899,658	D173G	probably damaging	Het
Itga11	A	G	9: 62,767,757	N857S	possibly damaging	Het
Kdm1b	C	A	13: 47,049,294	S68R	probably benign	Het
Ly6c1	C	A	15: 75,045,451	G116V	probably damaging	Het
Myo6	G	T	9: 80,255,003	V341L	unknown	Het
Nfkbie	C	A	17: 45,559,257	A176E	probably damaging	Het
Nlrp2	C	T	7: 5,327,479	M639I	probably benign	Het
Olfr1090	A	T	2: 86,754,010	S243T	probably damaging	Het
Olfr1140	A	G	2: 87,746,781	N195S	probably damaging	Het
Olfr1512	T	A	14: 52,372,259	S265C	probably damaging	Het
Olfr418	T	A	1: 173,270,580	I135N	possibly damaging	Het
Olfr680-ps1	T	C	7: 105,091,226	I138V	probably benign	Het
Olfr811	T	C	10: 129,801,695	T277A	probably damaging	Het
Pak4	G	A	7: 28,564,838	T213M	probably damaging	Het
Pan2	C	T	10: 128,317,941	Q1003*	probably null	Het
Pde4c	G	C	8: 70,726,901	V34L	probably benign	Het
Pi4k2a	G	A	19: 42,100,796	V199M	probably damaging	Het
Platr25	T	C	13: 62,700,193	E285G	probably damaging	Het
Polr3e	T	C	7: 120,937,683	V356A	possibly damaging	Het
Prcp	A	G	7: 92,917,809	D243G	probably benign	Het
Qsox2	T	C	2: 26,225,234	T161A	probably damaging	Het
Rhoj	A	G	12: 75,308,926	T35A		Het
Scn9a	T	A	2: 66,494,803	M1336L	probably damaging	Het
Sel1l2	G	T	2: 140,275,464	N162K	probably damaging	Het
Slc15a3	T	C	19: 10,843,502	L161P	probably damaging	Het
Slc4a11	G	A	2: 130,691,743	A100V	probably damaging	Het
Sp1	A	G	15: 102,407,885	S41G	probably benign	Het
Tfip11	A	G	5: 112,333,348	T397A	possibly damaging	Het
Themis	T	C	10: 28,781,753	S259P	probably damaging	Het
Tm7sf2	T	C	19: 6,067,142	Y77C	probably damaging	Het
Tnnt2	C	A	1: 135,846,746	P81H	possibly damaging	Het
Trpc7	T	C	13: 56,888,073	T16A	probably benign	Het
Ttc30a2	G	A	2: 75,977,871	T99I	probably benign	Het
Ttn	T	A	2: 76,914,712	Y5331F	possibly damaging	Het
Virma	A	G	4: 11,526,922	Q1057R	possibly damaging	Het
Vmn2r118	A	T	17: 55,611,649	F81Y	probably damaging	Het
Vmn2r88	T	C	14: 51,414,033	V268A		Het
Vmn2r93	T	A	17: 18,304,209	M155K	probably benign	Het
Vps13b	G	T	15: 35,875,785	C2772F	possibly damaging	Het
Wdr90	T	C	17: 25,857,226	N86D		Het
Zbtb34	T	C	2: 33,411,236	D431G	probably damaging	Het
Zc3h3	G	A	15: 75,839,388	P408L	probably benign	Het
Zfp345	A	G	2: 150,471,944	Y558H	probably benign	Het
Zfp583	G	A	7: 6,316,544	P490S	probably damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCACAGCAGTTCTCTGTC -3'
(R):5'- TTGAGTGGGGTCCTTTAACTCAC -3'

Sequencing Primer
(F):5'- ACCACAGCAGTTCTCTGTCATTTC -3'
(R):5'- AGTGGGGTCCTTTAACTCACATGTC -3'

Posted On

2021-11-19