Incidental Mutation 'R9176:Snx29'
ID 696710
Institutional Source Beutler Lab
Gene Symbol Snx29
Ensembl Gene ENSMUSG00000071669
Gene Name sorting nexin 29
Synonyms 4933437K13Rik, LOC381035, LOC385605, Gm11170, Rundc2a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9176 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 11322908-11755472 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11418864 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 90 (N90D)
Ref Sequence ENSEMBL: ENSMUSP00000093993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096273] [ENSMUST00000122168] [ENSMUST00000150993] [ENSMUST00000180792]
AlphaFold Q9D3S3
Predicted Effect probably benign
Transcript: ENSMUST00000096273
AA Change: N90D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093993
Gene: ENSMUSG00000071669
AA Change: N90D

DomainStartEndE-ValueType
low complexity region 103 120 N/A INTRINSIC
coiled coil region 125 206 N/A INTRINSIC
PX 319 422 3.13e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122168
AA Change: N74D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113595
Gene: ENSMUSG00000071669
AA Change: N74D

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
coiled coil region 110 191 N/A INTRINSIC
Blast:PX 301 326 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150993
SMART Domains Protein: ENSMUSP00000117896
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
coiled coil region 23 104 N/A INTRINSIC
Blast:PX 217 245 3e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180792
AA Change: N432D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138025
Gene: ENSMUSG00000071669
AA Change: N432D

DomainStartEndE-ValueType
low complexity region 64 74 N/A INTRINSIC
RUN 115 178 7.89e-26 SMART
internal_repeat_1 192 211 2.63e-5 PROSPERO
internal_repeat_1 203 222 2.63e-5 PROSPERO
low complexity region 252 262 N/A INTRINSIC
low complexity region 270 275 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
coiled coil region 467 548 N/A INTRINSIC
PX 661 764 3.13e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T C 5: 146,184,194 D119G probably damaging Het
1700123K08Rik T C 5: 138,562,893 D169G probably damaging Het
4932438A13Rik T A 3: 36,956,703 V1750E possibly damaging Het
Abcd2 T G 15: 91,191,420 R63S probably benign Het
Ankrd55 T C 13: 112,323,076 V68A possibly damaging Het
Avil T C 10: 127,016,379 Y678H probably damaging Het
Cd300ld2 C A 11: 115,013,946 E32* probably null Het
Chuk A T 19: 44,088,003 L423Q probably damaging Het
Cisd3 A G 11: 97,688,301 T90A probably damaging Het
Cmpk2 T A 12: 26,474,028 S275T probably benign Het
Cntnap5c T A 17: 58,313,735 N936K probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col4a4 G T 1: 82,485,628 P1047Q unknown Het
Col6a4 A G 9: 106,061,556 L1321P probably damaging Het
Crat A G 2: 30,407,880 F211L probably damaging Het
Csmd3 T C 15: 48,001,541 Q27R Het
Dapk1 T C 13: 60,718,448 V205A probably damaging Het
Ddx20 T C 3: 105,678,842 N729S probably benign Het
Derl2 A G 11: 71,013,550 V139A possibly damaging Het
Dscam C T 16: 96,685,353 D1041N probably benign Het
E2f4 TAGCAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAG TAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAG 8: 105,301,368 probably benign Het
Fam160b2 T C 14: 70,589,100 K183E probably benign Het
Fbxo2 A T 4: 148,165,690 R226W probably damaging Het
Gm4070 T C 7: 105,902,055 K597E possibly damaging Het
Gpr19 A G 6: 134,869,755 S322P probably damaging Het
Herc6 A G 6: 57,659,678 N793S probably benign Het
Ikbke A T 1: 131,263,288 S563T probably benign Het
Il1r2 T C 1: 40,105,318 L55P probably damaging Het
Klhl8 C A 5: 103,864,245 A575S probably benign Het
Lims1 T G 10: 58,418,443 C340G probably damaging Het
Loxl3 G A 6: 83,049,311 C460Y probably damaging Het
Mapk9 T A 11: 49,872,738 L152* probably null Het
Mef2d T C 3: 88,159,156 V144A possibly damaging Het
Mertk A G 2: 128,778,972 D578G possibly damaging Het
Mettl1 C A 10: 127,045,381 Q254K probably benign Het
Naip2 T C 13: 100,162,199 E443G probably damaging Het
Ndor1 A G 2: 25,248,229 F484L probably damaging Het
Neurl1b C T 17: 26,441,081 T425I possibly damaging Het
Nomo1 G A 7: 46,081,404 V1104M possibly damaging Het
Olfr1257 T C 2: 89,881,171 V115A probably benign Het
Olfr1340 T A 4: 118,726,653 Y135* probably null Het
Olfr1443 A G 19: 12,680,236 M43V probably benign Het
Olfr1501 A G 19: 13,838,432 V247A probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr480 A G 7: 108,066,039 V223A probably benign Het
Olfr525 G T 7: 140,323,208 G170C probably damaging Het
Parp4 A G 14: 56,635,817 K1173E possibly damaging Het
Phkb T A 8: 85,970,994 N477K probably damaging Het
Plekha7 T G 7: 116,140,691 I812L possibly damaging Het
Plxnb1 A G 9: 109,112,583 T1711A probably damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Pomt2 T A 12: 87,147,677 probably benign Het
Prdm1 T C 10: 44,440,127 H671R probably damaging Het
Prkca G A 11: 107,979,418 R15C possibly damaging Het
Prkch T A 12: 73,700,194 N282K probably damaging Het
Ptpn6 T C 6: 124,725,286 R385G probably benign Het
Rad21 A T 15: 51,978,059 M87K probably damaging Het
Safb2 ACTTCTTCT ACTTCT 17: 56,571,292 probably benign Het
Scn1a A T 2: 66,273,345 V1857E probably damaging Het
Shprh A G 10: 11,160,576 T386A probably benign Het
Slco1b2 T C 6: 141,652,503 L94P probably damaging Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tbc1d5 T C 17: 50,782,335 T584A probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tpp2 A G 1: 43,992,393 N1124D probably null Het
Trpv1 A T 11: 73,239,655 T196S probably benign Het
Ulk4 T C 9: 121,145,062 E968G probably benign Het
Zbtb8a G T 4: 129,360,428 T91K probably damaging Het
Zfp317 T A 9: 19,647,867 V459E probably damaging Het
Zfp790 A G 7: 29,829,962 T691A probably benign Het
Other mutations in Snx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Snx29 APN 16 11403502 missense probably damaging 0.97
IGL02207:Snx29 APN 16 11738352 missense probably damaging 1.00
PIT1430001:Snx29 UTSW 16 11403624 missense probably benign 0.00
PIT4810001:Snx29 UTSW 16 11400981 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0276:Snx29 UTSW 16 11738373 missense probably benign 0.01
R0506:Snx29 UTSW 16 11395303 missense probably benign 0.15
R0621:Snx29 UTSW 16 11405787 splice site probably null
R0975:Snx29 UTSW 16 11347871 missense possibly damaging 0.66
R1225:Snx29 UTSW 16 11420686 intron probably benign
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1452:Snx29 UTSW 16 11631471 missense probably damaging 1.00
R1515:Snx29 UTSW 16 11399837 critical splice donor site probably null
R1874:Snx29 UTSW 16 11367681 missense probably benign 0.01
R1953:Snx29 UTSW 16 11399783 nonsense probably null
R1978:Snx29 UTSW 16 11367724 missense probably benign 0.23
R2054:Snx29 UTSW 16 11631492 missense probably damaging 1.00
R2105:Snx29 UTSW 16 11511034 missense possibly damaging 0.72
R2128:Snx29 UTSW 16 11400971 missense probably damaging 0.98
R2152:Snx29 UTSW 16 11400843 missense possibly damaging 0.95
R2912:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R2913:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R2914:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R4468:Snx29 UTSW 16 11420701 splice site probably null
R4469:Snx29 UTSW 16 11420701 splice site probably null
R4612:Snx29 UTSW 16 11447495 missense probably damaging 0.99
R4744:Snx29 UTSW 16 11349909 nonsense probably null
R4798:Snx29 UTSW 16 11420736 missense probably damaging 1.00
R5000:Snx29 UTSW 16 11403507 missense probably damaging 0.99
R5165:Snx29 UTSW 16 11420775 missense probably damaging 0.98
R5207:Snx29 UTSW 16 11738363 missense probably damaging 1.00
R5235:Snx29 UTSW 16 11413246 missense possibly damaging 0.94
R5274:Snx29 UTSW 16 11738404 missense probably damaging 1.00
R5277:Snx29 UTSW 16 11399824 missense possibly damaging 0.82
R5462:Snx29 UTSW 16 11511012 missense possibly damaging 0.89
R5655:Snx29 UTSW 16 11755321 missense probably damaging 1.00
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6326:Snx29 UTSW 16 11403566 missense probably benign
R6576:Snx29 UTSW 16 11715056 critical splice donor site probably null
R7406:Snx29 UTSW 16 11755316 missense probably damaging 1.00
R7552:Snx29 UTSW 16 11420785 critical splice donor site probably null
R7555:Snx29 UTSW 16 11400942 missense probably benign 0.02
R7736:Snx29 UTSW 16 11367724 missense probably benign 0.23
R7962:Snx29 UTSW 16 11413357 critical splice donor site probably null
R8101:Snx29 UTSW 16 11571716 missense probably benign 0.16
R8415:Snx29 UTSW 16 11447427 missense probably damaging 1.00
R8549:Snx29 UTSW 16 11715056 critical splice donor site probably null
R9010:Snx29 UTSW 16 11631527 missense probably benign 0.00
R9091:Snx29 UTSW 16 11395291 missense probably benign 0.33
R9099:Snx29 UTSW 16 11660571 missense probably damaging 1.00
R9258:Snx29 UTSW 16 11714935 missense possibly damaging 0.78
R9270:Snx29 UTSW 16 11395291 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGCCTGTTCAAAAGAAATGGG -3'
(R):5'- GTACACTGGCAACTTAGTTTTCTGG -3'

Sequencing Primer
(F):5'- CCTGTTCAAAAGAAATGGGTAGTAC -3'
(R):5'- TCTATTTCTTCGATCTGAGCACAAAC -3'
Posted On 2022-02-07