Incidental Mutation 'R0621:Snx29'
ID58696
Institutional Source Beutler Lab
Gene Symbol Snx29
Ensembl Gene ENSMUSG00000071669
Gene Namesorting nexin 29
Synonyms4933437K13Rik, LOC381035, LOC385605, Gm11170, Rundc2a
MMRRC Submission 038810-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0621 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location11322908-11755472 bp(+) (GRCm38)
Type of Mutationsplice site (1951 bp from exon)
DNA Base Change (assembly) A to G at 11405787 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096273] [ENSMUST00000115814] [ENSMUST00000122168] [ENSMUST00000180792]
Predicted Effect probably benign
Transcript: ENSMUST00000096273
AA Change: E32G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093993
Gene: ENSMUSG00000071669
AA Change: E32G

DomainStartEndE-ValueType
low complexity region 103 120 N/A INTRINSIC
coiled coil region 125 206 N/A INTRINSIC
PX 319 422 3.13e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115814
SMART Domains Protein: ENSMUSP00000111481
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 64 74 N/A INTRINSIC
RUN 115 178 7.89e-26 SMART
internal_repeat_1 192 211 2.98e-5 PROSPERO
internal_repeat_1 203 222 2.98e-5 PROSPERO
low complexity region 252 262 N/A INTRINSIC
low complexity region 270 275 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122168
SMART Domains Protein: ENSMUSP00000113595
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
coiled coil region 110 191 N/A INTRINSIC
Blast:PX 301 326 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180792
SMART Domains Protein: ENSMUSP00000138025
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 64 74 N/A INTRINSIC
RUN 115 178 7.89e-26 SMART
internal_repeat_1 192 211 2.63e-5 PROSPERO
internal_repeat_1 203 222 2.63e-5 PROSPERO
low complexity region 252 262 N/A INTRINSIC
low complexity region 270 275 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
coiled coil region 467 548 N/A INTRINSIC
PX 661 764 3.13e-9 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,509,072 D33G probably damaging Het
Adgre1 T A 17: 57,441,359 S520T probably damaging Het
Ankrd40 A G 11: 94,339,607 probably null Het
Aph1b A T 9: 66,779,334 I177K possibly damaging Het
Armc3 A T 2: 19,295,393 N579I probably damaging Het
Atxn7l1 T C 12: 33,326,100 V131A probably benign Het
C130073F10Rik A G 4: 101,890,795 Y61H probably damaging Het
C1s2 A T 6: 124,631,112 L214Q probably damaging Het
Caprin2 A T 6: 148,858,678 S425T possibly damaging Het
Cdc42ep4 G A 11: 113,728,696 R290C probably damaging Het
Cenpf T C 1: 189,672,628 T352A probably benign Het
Col6a4 A T 9: 106,066,791 F1161L probably damaging Het
Dctn2 T C 10: 127,277,940 probably null Het
Ddx24 T C 12: 103,425,558 probably benign Het
Dsg1c C A 18: 20,279,695 A591D possibly damaging Het
Efnb3 T C 11: 69,555,972 D304G probably damaging Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Eya3 T G 4: 132,694,802 D275E probably benign Het
Fam81a G T 9: 70,093,647 Q272K probably benign Het
Foxf1 T C 8: 121,085,180 V261A probably damaging Het
Gm9637 G A 14: 19,402,011 noncoding transcript Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gtf2h2 A T 13: 100,488,925 L61Q probably damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hoxb3 A T 11: 96,345,963 Y289F probably damaging Het
Kctd3 C T 1: 188,981,341 R399Q probably damaging Het
Kif26b C G 1: 178,915,653 P1105A probably benign Het
Klhl30 C T 1: 91,357,863 T369M probably damaging Het
Lipo2 C T 19: 33,730,939 G225D probably damaging Het
Macf1 T C 4: 123,380,534 K6350E probably damaging Het
Myh13 A C 11: 67,341,232 N446T probably damaging Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Olfr1250 C A 2: 89,657,115 E109* probably null Het
Olfr418 C T 1: 173,270,675 P167S possibly damaging Het
Olfr746 G A 14: 50,653,962 G242R possibly damaging Het
Pde3a T C 6: 141,249,999 L137P probably damaging Het
Ppm1f G A 16: 16,915,308 R233Q probably benign Het
Rtf2 C A 2: 172,466,296 A205E possibly damaging Het
Sh2d5 T C 4: 138,258,318 F359S probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc39a11 G A 11: 113,464,079 P108L probably benign Het
Slc6a5 G A 7: 49,917,365 probably null Het
Snph C T 2: 151,593,722 V360M probably damaging Het
Sos1 A G 17: 80,451,979 probably null Het
Spata5 C T 3: 37,432,029 T300I probably benign Het
St8sia6 T A 2: 13,657,282 N246I probably damaging Het
Thy1 T A 9: 44,046,733 F53I probably damaging Het
Tle3 T A 9: 61,410,105 Y421* probably null Het
Ttc21b C T 2: 66,226,011 R677Q probably benign Het
Vmn2r107 A T 17: 20,374,990 I602F probably benign Het
Wdr17 C A 8: 54,643,191 G1016C probably benign Het
Wdr62 T C 7: 30,254,061 E182G possibly damaging Het
Zfp597 A G 16: 3,866,364 I176T probably benign Het
Other mutations in Snx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Snx29 APN 16 11403502 missense probably damaging 0.97
IGL02207:Snx29 APN 16 11738352 missense probably damaging 1.00
PIT1430001:Snx29 UTSW 16 11403624 missense probably benign 0.00
PIT4810001:Snx29 UTSW 16 11400981 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0276:Snx29 UTSW 16 11738373 missense probably benign 0.01
R0506:Snx29 UTSW 16 11395303 missense probably benign 0.15
R0975:Snx29 UTSW 16 11347871 missense possibly damaging 0.66
R1225:Snx29 UTSW 16 11420686 intron probably benign
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1452:Snx29 UTSW 16 11631471 missense probably damaging 1.00
R1515:Snx29 UTSW 16 11399837 critical splice donor site probably null
R1874:Snx29 UTSW 16 11367681 missense probably benign 0.01
R1953:Snx29 UTSW 16 11399783 nonsense probably null
R1978:Snx29 UTSW 16 11367724 missense probably benign 0.23
R2054:Snx29 UTSW 16 11631492 missense probably damaging 1.00
R2105:Snx29 UTSW 16 11511034 missense possibly damaging 0.72
R2128:Snx29 UTSW 16 11400971 missense probably damaging 0.98
R2152:Snx29 UTSW 16 11400843 missense possibly damaging 0.95
R2912:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R2913:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R2914:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R4468:Snx29 UTSW 16 11420701 splice site probably null
R4469:Snx29 UTSW 16 11420701 splice site probably null
R4612:Snx29 UTSW 16 11447495 missense probably damaging 0.99
R4744:Snx29 UTSW 16 11349909 nonsense probably null
R4798:Snx29 UTSW 16 11420736 missense probably damaging 1.00
R5000:Snx29 UTSW 16 11403507 missense probably damaging 0.99
R5165:Snx29 UTSW 16 11420775 missense probably damaging 0.98
R5207:Snx29 UTSW 16 11738363 missense probably damaging 1.00
R5235:Snx29 UTSW 16 11413246 missense possibly damaging 0.94
R5274:Snx29 UTSW 16 11738404 missense probably damaging 1.00
R5277:Snx29 UTSW 16 11399824 missense possibly damaging 0.82
R5462:Snx29 UTSW 16 11511012 missense possibly damaging 0.89
R5655:Snx29 UTSW 16 11755321 missense probably damaging 1.00
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6326:Snx29 UTSW 16 11403566 missense probably benign
R6576:Snx29 UTSW 16 11715056 critical splice donor site probably null
R7406:Snx29 UTSW 16 11755316 missense probably damaging 1.00
R7552:Snx29 UTSW 16 11420785 critical splice donor site probably null
R7555:Snx29 UTSW 16 11400942 missense probably benign 0.02
R7736:Snx29 UTSW 16 11367724 missense probably benign 0.23
R7962:Snx29 UTSW 16 11413357 critical splice donor site probably null
R8101:Snx29 UTSW 16 11571716 missense probably benign 0.16
R8415:Snx29 UTSW 16 11447427 missense probably damaging 1.00
R8549:Snx29 UTSW 16 11715056 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCCACTGCATTCTGTGGCTCTG -3'
(R):5'- GCATGGCTCATGCTTGTAACTCGG -3'

Sequencing Primer
(F):5'- TGTGAGTCAATGCCTGAGCC -3'
(R):5'- GTCAACACTTGTGATAGATACTGG -3'
Posted On2013-07-11