Incidental Mutation 'R9192:Tnrc18'
ID 697741
Institutional Source Beutler Lab
Gene Symbol Tnrc18
Ensembl Gene ENSMUSG00000039477
Gene Name trinucleotide repeat containing 18
Synonyms Zfp469, EG381742
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock # R9192 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 142724661-142817662 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 142787847 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 409 (R409L)
Ref Sequence ENSEMBL: ENSMUSP00000114769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151477] [ENSMUST00000152247]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000114769
Gene: ENSMUSG00000039477
AA Change: R409L

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
coiled coil region 843 876 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 951 970 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
low complexity region 1269 1289 N/A INTRINSIC
coiled coil region 1411 1443 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1581 1593 N/A INTRINSIC
low complexity region 1608 1619 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152247
AA Change: R226L
SMART Domains Protein: ENSMUSP00000117651
Gene: ENSMUSG00000039477
AA Change: R226L

DomainStartEndE-ValueType
low complexity region 57 104 N/A INTRINSIC
low complexity region 186 207 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 733 747 N/A INTRINSIC
low complexity region 768 787 N/A INTRINSIC
low complexity region 797 810 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
low complexity region 1086 1106 N/A INTRINSIC
coiled coil region 1228 1260 N/A INTRINSIC
low complexity region 1294 1310 N/A INTRINSIC
low complexity region 1398 1410 N/A INTRINSIC
low complexity region 1425 1436 N/A INTRINSIC
coiled coil region 1570 1592 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1641 1653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T A 7: 75,704,501 M71K probably benign Het
Angptl4 C T 17: 33,781,311 A28T probably benign Het
Baz1b T G 5: 135,210,794 N249K possibly damaging Het
BC035947 A T 1: 78,499,240 Y218* probably null Het
Ctbp1 T C 5: 33,250,989 I211V probably benign Het
Dars T C 1: 128,372,152 E365G probably benign Het
E2f7 G T 10: 110,763,990 R202L probably damaging Het
Fscb A C 12: 64,474,116 I192S possibly damaging Het
Fsip2 A G 2: 82,987,500 I4526V probably benign Het
Gm9008 T C 6: 76,496,583 D350G probably benign Het
Gucy2e A T 11: 69,236,477 F57I probably damaging Het
Hcar2 A T 5: 123,865,291 C50S possibly damaging Het
Herc1 G A 9: 66,414,131 V1267I probably benign Het
Kansl1 A T 11: 104,336,316 D845E probably damaging Het
Kdm2b T A 5: 122,932,616 T473S probably benign Het
Klhdc10 T A 6: 30,449,500 I327N probably damaging Het
Kmt5b T C 19: 3,804,442 L235P probably damaging Het
Lama2 C T 10: 27,328,185 E486K possibly damaging Het
Lhx6 A T 2: 36,091,133 W266R probably benign Het
Mettl15 A T 2: 109,274,465 L65* probably null Het
Mocos A G 18: 24,679,537 Q496R probably benign Het
Neb T C 2: 52,313,835 S285G probably damaging Het
Nos3 A G 5: 24,377,613 N613S probably benign Het
Nphs2 G A 1: 156,310,816 R10Q probably benign Het
Olfr1274-ps C A 2: 90,401,372 T237N probably damaging Het
Olfr641 A T 7: 104,040,668 I291F possibly damaging Het
Olfr698 A G 7: 106,753,223 L55P probably damaging Het
Osbpl10 T C 9: 115,167,226 C119R probably damaging Het
Otop1 T C 5: 38,287,930 V144A probably benign Het
Ovca2 A G 11: 75,178,036 V179A possibly damaging Het
Pcdha11 A G 18: 37,007,474 T719A probably benign Het
Pcdhga1 A G 18: 37,840,031 N900D probably damaging Het
Pcdhga8 A T 18: 37,726,110 Q73L probably damaging Het
Pclo A G 5: 14,540,190 K835E unknown Het
Psmd2 T A 16: 20,654,662 Y158N probably damaging Het
Pygl A G 12: 70,197,048 V631A probably damaging Het
Rhoq A T 17: 86,996,977 I179F Het
Rps6kb1 T C 11: 86,513,555 I257M probably damaging Het
Sall3 G A 18: 80,973,909 A268V probably benign Het
Serinc4 G A 2: 121,456,769 probably benign Het
Slc27a2 T A 2: 126,587,887 M605K probably damaging Het
Slc5a7 T C 17: 54,287,361 I197M probably benign Het
Slc6a7 A G 18: 61,000,577 Y516H probably damaging Het
Spag16 A G 1: 69,923,848 T385A unknown Het
Stat6 G A 10: 127,657,610 R600H probably damaging Het
Stk32b A G 5: 37,629,000 V40A probably damaging Het
Sv2c T A 13: 96,088,247 I185L probably benign Het
Syne2 T A 12: 76,109,929 L2115H probably damaging Het
Tas2r121 T C 6: 132,700,529 E160G probably benign Het
Tle1 G T 4: 72,118,516 T727K probably benign Het
Tmem79 A T 3: 88,333,457 D61E probably benign Het
Tnrc6a C A 7: 123,189,953 P1665Q probably damaging Het
Tns2 C A 15: 102,112,981 P1027Q probably damaging Het
Trav7-5 C G 14: 53,531,158 A61G probably benign Het
Ttn A G 2: 76,914,911 S5265P possibly damaging Het
Tuba1c T A 15: 99,037,856 Y399* probably null Het
Vav2 A T 2: 27,282,382 I504N probably damaging Het
Vmn2r5 G T 3: 64,491,517 C680* probably null Het
Zfp644 G C 5: 106,637,963 S239R probably benign Het
Zfp954 C T 7: 7,115,934 G204S probably damaging Het
Zswim8 C T 14: 20,719,520 T1265I probably damaging Het
Other mutations in Tnrc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tnrc18 APN 5 142763037 missense unknown
IGL01732:Tnrc18 APN 5 142772061 missense unknown
IGL01796:Tnrc18 APN 5 142764887 missense possibly damaging 0.88
IGL01868:Tnrc18 APN 5 142771812 missense unknown
IGL02010:Tnrc18 APN 5 142787294 missense unknown
IGL02566:Tnrc18 APN 5 142772313 splice site probably benign
IGL02688:Tnrc18 APN 5 142790172 missense probably damaging 0.96
IGL03052:Tnrc18 UTSW 5 142775219 missense unknown
R0129:Tnrc18 UTSW 5 142765045 splice site probably benign
R0617:Tnrc18 UTSW 5 142776739 missense unknown
R0894:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1056:Tnrc18 UTSW 5 142773859 nonsense probably null
R1084:Tnrc18 UTSW 5 142764767 critical splice donor site probably null
R1131:Tnrc18 UTSW 5 142787208 missense unknown
R1411:Tnrc18 UTSW 5 142765947 missense unknown
R1443:Tnrc18 UTSW 5 142771533 missense unknown
R1681:Tnrc18 UTSW 5 142773817 missense unknown
R1698:Tnrc18 UTSW 5 142788703 missense possibly damaging 0.83
R1795:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1903:Tnrc18 UTSW 5 142815140 missense probably damaging 0.99
R1930:Tnrc18 UTSW 5 142776324 missense unknown
R1931:Tnrc18 UTSW 5 142776324 missense unknown
R1941:Tnrc18 UTSW 5 142815150 missense probably damaging 1.00
R2069:Tnrc18 UTSW 5 142766087 missense unknown
R2074:Tnrc18 UTSW 5 142759706 splice site probably null
R2089:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2182:Tnrc18 UTSW 5 142760061 missense unknown
R2190:Tnrc18 UTSW 5 142775889 missense unknown
R2310:Tnrc18 UTSW 5 142788553 missense probably damaging 0.96
R2372:Tnrc18 UTSW 5 142759704 splice site probably benign
R2445:Tnrc18 UTSW 5 142772115 missense unknown
R3806:Tnrc18 UTSW 5 142787274 missense unknown
R4097:Tnrc18 UTSW 5 142773806 small deletion probably benign
R4153:Tnrc18 UTSW 5 142765992 missense possibly damaging 0.89
R4274:Tnrc18 UTSW 5 142743650 missense unknown
R4520:Tnrc18 UTSW 5 142732150 missense unknown
R4627:Tnrc18 UTSW 5 142740128 missense unknown
R4852:Tnrc18 UTSW 5 142731340 missense probably damaging 0.98
R4873:Tnrc18 UTSW 5 142765177 missense unknown
R4875:Tnrc18 UTSW 5 142765177 missense unknown
R4876:Tnrc18 UTSW 5 142731625 missense unknown
R4936:Tnrc18 UTSW 5 142765977 nonsense probably null
R4942:Tnrc18 UTSW 5 142787982 missense unknown
R4962:Tnrc18 UTSW 5 142739493 missense unknown
R5373:Tnrc18 UTSW 5 142740156 missense unknown
R5374:Tnrc18 UTSW 5 142740156 missense unknown
R5454:Tnrc18 UTSW 5 142771691 missense unknown
R5678:Tnrc18 UTSW 5 142733564 missense unknown
R5826:Tnrc18 UTSW 5 142773747 missense unknown
R5891:Tnrc18 UTSW 5 142815171 missense probably damaging 0.99
R6195:Tnrc18 UTSW 5 142765173 missense unknown
R6296:Tnrc18 UTSW 5 142733576 missense unknown
R6358:Tnrc18 UTSW 5 142727981 missense probably damaging 0.99
R6452:Tnrc18 UTSW 5 142727012 missense probably damaging 1.00
R6498:Tnrc18 UTSW 5 142732168 missense unknown
R6711:Tnrc18 UTSW 5 142787790 missense unknown
R6782:Tnrc18 UTSW 5 142787308 missense unknown
R6863:Tnrc18 UTSW 5 142815197 missense probably damaging 1.00
R6894:Tnrc18 UTSW 5 142760049 missense unknown
R6970:Tnrc18 UTSW 5 142727989 missense probably damaging 0.99
R7053:Tnrc18 UTSW 5 142787229 missense unknown
R7135:Tnrc18 UTSW 5 142787817 missense
R7756:Tnrc18 UTSW 5 142787152 missense
R7902:Tnrc18 UTSW 5 142772147 missense
R8039:Tnrc18 UTSW 5 142732052 missense unknown
R8053:Tnrc18 UTSW 5 142750630 missense unknown
R8322:Tnrc18 UTSW 5 142726012 missense probably damaging 1.00
R8379:Tnrc18 UTSW 5 142788402 missense
R8745:Tnrc18 UTSW 5 142787447 missense
R8837:Tnrc18 UTSW 5 142793056 missense possibly damaging 0.94
R8894:Tnrc18 UTSW 5 142739457 missense unknown
R8909:Tnrc18 UTSW 5 142776376 missense
R9030:Tnrc18 UTSW 5 142726063 missense probably damaging 1.00
R9186:Tnrc18 UTSW 5 142787733 missense
R9189:Tnrc18 UTSW 5 142731352 missense probably damaging 1.00
R9227:Tnrc18 UTSW 5 142787637 missense
R9230:Tnrc18 UTSW 5 142787637 missense
RF022:Tnrc18 UTSW 5 142773630 missense
Z1177:Tnrc18 UTSW 5 142773888 missense
Predicted Primers PCR Primer
(F):5'- TTTGATGAGGCTCTGCATAGC -3'
(R):5'- ATCCAGATAGCATCCCAGGC -3'

Sequencing Primer
(F):5'- TGCATAGCAGAGGCCTCTC -3'
(R):5'- TGCAAGGTCCACCCGGATC -3'
Posted On 2022-02-07