Incidental Mutation 'RF022:Tnrc18'
Institutional Source Beutler Lab
Gene Symbol Tnrc18
Ensembl Gene ENSMUSG00000039477
Gene Nametrinucleotide repeat containing 18
SynonymsZfp469, EG381742
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #RF022 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location142724661-142817662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 142773630 bp
Amino Acid Change Alanine to Valine at position 999 (A999V)
Ref Sequence ENSEMBL: ENSMUSP00000114769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151477] [ENSMUST00000152247]
Predicted Effect
SMART Domains Protein: ENSMUSP00000114769
Gene: ENSMUSG00000039477
AA Change: A999V

low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
coiled coil region 843 876 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 951 970 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
low complexity region 1269 1289 N/A INTRINSIC
coiled coil region 1411 1443 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1581 1593 N/A INTRINSIC
low complexity region 1608 1619 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152247
AA Change: A817V
SMART Domains Protein: ENSMUSP00000117651
Gene: ENSMUSG00000039477
AA Change: A817V

low complexity region 57 104 N/A INTRINSIC
low complexity region 186 207 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 733 747 N/A INTRINSIC
low complexity region 768 787 N/A INTRINSIC
low complexity region 797 810 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
low complexity region 1086 1106 N/A INTRINSIC
coiled coil region 1228 1260 N/A INTRINSIC
low complexity region 1294 1310 N/A INTRINSIC
low complexity region 1398 1410 N/A INTRINSIC
low complexity region 1425 1436 N/A INTRINSIC
coiled coil region 1570 1592 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1641 1653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik GTACT GTACTACT 12: 110,668,443 probably null Het
Adam6b A T 12: 113,491,669 E702V possibly damaging Het
Arpc3 A G 5: 122,400,426 T7A probably benign Het
Bcl3 G A 7: 19,809,041 P393L probably damaging Het
Ceacam9 A G 7: 16,725,379 D201G possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Clgn A G 8: 83,425,606 K579R probably damaging Het
Cntnap2 C T 6: 47,021,665 R884W probably damaging Het
Col6a4 A T 9: 106,077,008 D377E probably damaging Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
D5Ertd579e A C 5: 36,614,662 I796M probably damaging Het
Dpagt1 G T 9: 44,331,965 V266L possibly damaging Het
Ebf3 C A 7: 137,313,942 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Gab3 CTT CTTATT X: 74,999,994 probably null Het
Golga4 A G 9: 118,557,989 D1393G probably damaging Het
Gpc5 G A 14: 115,552,276 V521I probably damaging Het
Grik1 A T 16: 87,896,337 N859K Het
Insrr G A 3: 87,804,485 A511T possibly damaging Het
Isx A G 8: 74,873,846 D69G probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lkaaear1 CAGCTCCAG CAGCTCCAGGTCGAGCTCCAG 2: 181,697,577 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Magel2 A G 7: 62,380,093 E915G unknown Het
Maml3 A G 3: 51,856,662 S294P probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mef2d A T 3: 88,168,267 T486S probably benign Het
Ms4a8a A G 19: 11,076,325 V139A possibly damaging Het
Olfr372 T G 8: 72,058,624 *315G probably null Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Het
Ppfibp2 T C 7: 107,697,610 L177P probably damaging Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Ptprh A G 7: 4,549,368 F966L probably benign Het
Rad17 A G 13: 100,637,085 L132S probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rwdd2b C T 16: 87,436,670 A181T probably benign Het
Sh3pxd2b GCCTGT GCCTGTTCCTGT 11: 32,423,054 probably benign Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Sla C T 15: 66,782,744 G231D probably benign Het
Tcof1 CAG CAGTAG 18: 60,835,735 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tgm5 T A 2: 121,071,611 E192D probably damaging Het
Tmem123 A G 9: 7,791,413 Y171C probably damaging Het
Triobp C T 15: 78,974,282 P1361L probably benign Het
Ubac1 A T 2: 26,005,458 W328R probably damaging Het
Ube2q1 A G 3: 89,780,893 N324S probably benign Het
Zcchc2 T C 1: 106,011,742 I407T possibly damaging Het
Other mutations in Tnrc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tnrc18 APN 5 142763037 missense unknown
IGL01732:Tnrc18 APN 5 142772061 missense unknown
IGL01796:Tnrc18 APN 5 142764887 missense possibly damaging 0.88
IGL01868:Tnrc18 APN 5 142771812 missense unknown
IGL02010:Tnrc18 APN 5 142787294 missense unknown
IGL02566:Tnrc18 APN 5 142772313 splice site probably benign
IGL02688:Tnrc18 APN 5 142790172 missense probably damaging 0.96
IGL03052:Tnrc18 UTSW 5 142775219 missense unknown
R0129:Tnrc18 UTSW 5 142765045 splice site probably benign
R0617:Tnrc18 UTSW 5 142776739 missense unknown
R0894:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1056:Tnrc18 UTSW 5 142773859 nonsense probably null
R1084:Tnrc18 UTSW 5 142764767 critical splice donor site probably null
R1131:Tnrc18 UTSW 5 142787208 missense unknown
R1411:Tnrc18 UTSW 5 142765947 missense unknown
R1443:Tnrc18 UTSW 5 142771533 missense unknown
R1681:Tnrc18 UTSW 5 142773817 missense unknown
R1698:Tnrc18 UTSW 5 142788703 missense possibly damaging 0.83
R1795:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1903:Tnrc18 UTSW 5 142815140 missense probably damaging 0.99
R1930:Tnrc18 UTSW 5 142776324 missense unknown
R1931:Tnrc18 UTSW 5 142776324 missense unknown
R1941:Tnrc18 UTSW 5 142815150 missense probably damaging 1.00
R2069:Tnrc18 UTSW 5 142766087 missense unknown
R2074:Tnrc18 UTSW 5 142759706 splice site probably null
R2089:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2182:Tnrc18 UTSW 5 142760061 missense unknown
R2190:Tnrc18 UTSW 5 142775889 missense unknown
R2310:Tnrc18 UTSW 5 142788553 missense probably damaging 0.96
R2372:Tnrc18 UTSW 5 142759704 splice site probably benign
R2445:Tnrc18 UTSW 5 142772115 missense unknown
R3806:Tnrc18 UTSW 5 142787274 missense unknown
R4097:Tnrc18 UTSW 5 142773806 small deletion probably benign
R4153:Tnrc18 UTSW 5 142765992 missense possibly damaging 0.89
R4274:Tnrc18 UTSW 5 142743650 missense unknown
R4520:Tnrc18 UTSW 5 142732150 missense unknown
R4627:Tnrc18 UTSW 5 142740128 missense unknown
R4852:Tnrc18 UTSW 5 142731340 missense probably damaging 0.98
R4873:Tnrc18 UTSW 5 142765177 missense unknown
R4875:Tnrc18 UTSW 5 142765177 missense unknown
R4876:Tnrc18 UTSW 5 142731625 missense unknown
R4936:Tnrc18 UTSW 5 142765977 nonsense probably null
R4942:Tnrc18 UTSW 5 142787982 missense unknown
R4962:Tnrc18 UTSW 5 142739493 missense unknown
R5373:Tnrc18 UTSW 5 142740156 missense unknown
R5374:Tnrc18 UTSW 5 142740156 missense unknown
R5454:Tnrc18 UTSW 5 142771691 missense unknown
R5678:Tnrc18 UTSW 5 142733564 missense unknown
R5826:Tnrc18 UTSW 5 142773747 missense unknown
R5891:Tnrc18 UTSW 5 142815171 missense probably damaging 0.99
R6195:Tnrc18 UTSW 5 142765173 missense unknown
R6296:Tnrc18 UTSW 5 142733576 missense unknown
R6358:Tnrc18 UTSW 5 142727981 missense probably damaging 0.99
R6452:Tnrc18 UTSW 5 142727012 missense probably damaging 1.00
R6498:Tnrc18 UTSW 5 142732168 missense unknown
R6711:Tnrc18 UTSW 5 142787790 missense unknown
R6782:Tnrc18 UTSW 5 142787308 missense unknown
R6863:Tnrc18 UTSW 5 142815197 missense probably damaging 1.00
R6894:Tnrc18 UTSW 5 142760049 missense unknown
R6970:Tnrc18 UTSW 5 142727989 missense probably damaging 0.99
R7053:Tnrc18 UTSW 5 142787229 missense unknown
R7135:Tnrc18 UTSW 5 142787817 missense
R7756:Tnrc18 UTSW 5 142787152 missense
R7902:Tnrc18 UTSW 5 142772147 missense
R8039:Tnrc18 UTSW 5 142732052 missense unknown
R8053:Tnrc18 UTSW 5 142750630 missense unknown
R8322:Tnrc18 UTSW 5 142726012 missense probably damaging 1.00
R8379:Tnrc18 UTSW 5 142788402 missense
R8745:Tnrc18 UTSW 5 142787447 missense
R8837:Tnrc18 UTSW 5 142793056 missense possibly damaging 0.94
R8894:Tnrc18 UTSW 5 142739457 missense unknown
R8909:Tnrc18 UTSW 5 142776376 missense
Z1177:Tnrc18 UTSW 5 142773888 missense
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04