Incidental Mutation 'R9289:Ncdn'
ID 704132
Institutional Source Beutler Lab
Gene Symbol Ncdn
Ensembl Gene ENSMUSG00000028833
Gene Name neurochondrin
Synonyms norbin, neurochondrin-1, neurochondrin-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9289 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126743750-126753438 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 126750110 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 306 (F306L)
Ref Sequence ENSEMBL: ENSMUSP00000030637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030637] [ENSMUST00000047431] [ENSMUST00000102607] [ENSMUST00000102608] [ENSMUST00000106116] [ENSMUST00000132660] [ENSMUST00000148935] [ENSMUST00000154640]
AlphaFold Q9Z0E0
Predicted Effect possibly damaging
Transcript: ENSMUST00000030637
AA Change: F306L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030637
Gene: ENSMUSG00000028833
AA Change: F306L

DomainStartEndE-ValueType
Pfam:Neurochondrin 30 637 3e-209 PFAM
low complexity region 649 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047431
SMART Domains Protein: ENSMUSP00000037802
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102607
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102608
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106116
AA Change: F306L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101722
Gene: ENSMUSG00000028833
AA Change: F306L

DomainStartEndE-ValueType
Pfam:Neurochondrin 30 637 9.1e-217 PFAM
low complexity region 649 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132660
Predicted Effect probably benign
Transcript: ENSMUST00000148935
Predicted Effect probably benign
Transcript: ENSMUST00000154640
SMART Domains Protein: ENSMUSP00000122352
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich cytoplasmic protein, which is highly similar to a mouse protein that negatively regulates Ca/calmodulin-dependent protein kinase II phosphorylation and may be essential for spatial learning processes. Several alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene results in early embryonic lethality in the homozygous state and impaired chondrocyte proliferation and differentiation in the heterozygous state. Gene trap mutation resulted in lacrimal gland hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,523 T306I probably benign Het
Aurkb T C 11: 69,050,349 I250T probably damaging Het
C1qtnf1 A G 11: 118,443,846 T51A probably benign Het
C1rb G T 6: 124,575,313 R330L possibly damaging Het
Cd8b1 G A 6: 71,329,793 probably null Het
Cep57l1 A T 10: 41,731,086 D160E probably damaging Het
Ces1f C T 8: 93,265,863 S320N probably benign Het
Cfap54 A G 10: 92,821,074 S3039P possibly damaging Het
Chia1 A T 3: 106,115,186 probably benign Het
Chka T G 19: 3,885,953 F220V possibly damaging Het
Cmtm2b A G 8: 104,322,348 probably benign Het
Dhx30 T C 9: 110,091,535 T304A possibly damaging Het
Dhx30 A T 9: 110,093,121 D164E probably benign Het
Dip2b A T 15: 100,173,271 K661I probably damaging Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dopey2 T A 16: 93,771,793 L1581H probably damaging Het
Fam219a C A 4: 41,521,942 G46V probably damaging Het
Fer1l6 G A 15: 58,618,917 V1028M probably damaging Het
Glb1 C A 9: 114,420,490 A129E probably damaging Het
Gm11492 T A 11: 87,568,966 C513* probably null Het
Heatr1 T C 13: 12,432,727 V1767A probably benign Het
Ift88 T A 14: 57,480,742 S591T probably benign Het
Itgb4 A G 11: 115,994,361 K1023R probably benign Het
Mfng C A 15: 78,759,257 S250I probably damaging Het
Mmp9 A G 2: 164,954,880 T723A probably benign Het
Mzf1 T A 7: 13,051,607 H299L probably benign Het
Naa40 T C 19: 7,234,120 K47E possibly damaging Het
Notch3 A G 17: 32,158,280 C246R probably damaging Het
Npc1l1 A T 11: 6,218,355 Y945* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1384 C T 11: 49,513,808 P57S probably damaging Het
Olfr332 T A 11: 58,489,919 I279L probably benign Het
Olfr669 T C 7: 104,938,609 W28R probably damaging Het
Pcnx C A 12: 81,982,079 D1044E Het
Pgm2l1 T A 7: 100,270,422 I575K probably damaging Het
Plat T C 8: 22,782,084 I553T probably damaging Het
Prrc2c A G 1: 162,679,561 V2513A probably benign Het
Qser1 A T 2: 104,787,248 V983E possibly damaging Het
Ring1 A G 17: 34,022,573 S190P possibly damaging Het
Rnf150 A G 8: 82,990,353 E163G probably benign Het
Scgb2b12 T C 7: 32,326,635 H44R probably benign Het
Shtn1 T C 19: 59,009,825 K379E probably damaging Het
Slc52a2 G T 15: 76,540,275 V238L probably benign Het
Smg1 T C 7: 118,145,416 H3171R possibly damaging Het
Tada3 A G 6: 113,370,303 V342A possibly damaging Het
Tbc1d20 T C 2: 152,311,342 V264A probably damaging Het
Tmco5 G A 2: 116,880,264 A22T probably benign Het
Tmem63b A G 17: 45,664,771 F549S probably benign Het
Trav16d-dv11 T C 14: 53,047,629 F54S probably benign Het
Trim7 A T 11: 48,845,454 K5* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp78 T C 7: 6,378,368 I139T probably benign Het
Zfp839 T A 12: 110,868,444 V711D probably benign Het
Other mutations in Ncdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ncdn APN 4 126747188 missense probably benign 0.00
R0031:Ncdn UTSW 4 126750108 splice site probably null
R0135:Ncdn UTSW 4 126746669 missense probably benign 0.37
R0413:Ncdn UTSW 4 126750534 missense possibly damaging 0.52
R1404:Ncdn UTSW 4 126750040 missense probably benign 0.33
R1404:Ncdn UTSW 4 126750040 missense probably benign 0.33
R1486:Ncdn UTSW 4 126748598 missense probably damaging 1.00
R1533:Ncdn UTSW 4 126748698 nonsense probably null
R1785:Ncdn UTSW 4 126745273 critical splice acceptor site probably null
R1786:Ncdn UTSW 4 126745273 critical splice acceptor site probably null
R1789:Ncdn UTSW 4 126752003 missense probably damaging 1.00
R1791:Ncdn UTSW 4 126751939 critical splice donor site probably null
R3406:Ncdn UTSW 4 126748595 missense probably benign 0.09
R4547:Ncdn UTSW 4 126746674 missense probably damaging 1.00
R4863:Ncdn UTSW 4 126750423 missense probably damaging 1.00
R4916:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R4917:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R4918:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R5218:Ncdn UTSW 4 126750810 missense probably benign 0.13
R5356:Ncdn UTSW 4 126747228 missense probably damaging 1.00
R5617:Ncdn UTSW 4 126745047 missense probably damaging 0.99
R5718:Ncdn UTSW 4 126749950 nonsense probably null
R6057:Ncdn UTSW 4 126745031 missense probably benign 0.05
R6343:Ncdn UTSW 4 126747171 missense possibly damaging 0.74
R6986:Ncdn UTSW 4 126747229 missense probably damaging 1.00
R6988:Ncdn UTSW 4 126747189 missense probably benign 0.00
R8257:Ncdn UTSW 4 126749883 critical splice donor site probably null
R8279:Ncdn UTSW 4 126750406 missense probably benign 0.00
R8804:Ncdn UTSW 4 126750105 missense probably benign 0.09
R8812:Ncdn UTSW 4 126745112 missense possibly damaging 0.52
R9047:Ncdn UTSW 4 126750828 missense possibly damaging 0.69
R9206:Ncdn UTSW 4 126750248 missense probably benign 0.03
R9208:Ncdn UTSW 4 126750248 missense probably benign 0.03
R9353:Ncdn UTSW 4 126750671 missense probably benign 0.00
R9420:Ncdn UTSW 4 126751969 missense probably damaging 1.00
R9578:Ncdn UTSW 4 126752002 missense not run
Z1176:Ncdn UTSW 4 126750151 missense probably damaging 1.00
Z1176:Ncdn UTSW 4 126750153 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTCACGAGCTGAACCTTCTGTG -3'
(R):5'- CCGAAGATGCCAGCAAGTTTG -3'

Sequencing Primer
(F):5'- GAACCTTCTGTGGCTCCTTAAG -3'
(R):5'- ATGCCAGCAAGTTTGAGCTC -3'
Posted On 2022-03-25