Incidental Mutation 'R9340:Ubr4'
ID 707433
Institutional Source Beutler Lab
Gene Symbol Ubr4
Ensembl Gene ENSMUSG00000066036
Gene Name ubiquitin protein ligase E3 component n-recognin 4
Synonyms p600, A930005E13Rik, LOC381562, D930005K06Rik, Zubr1, 1810009A16Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9340 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 139107970-139216844 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139182763 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 383 (I383N)
Ref Sequence ENSEMBL: ENSMUSP00000117419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000147999] [ENSMUST00000165860]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000097822
AA Change: I3542N
SMART Domains Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036
AA Change: I3542N

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1660 1725 1.9e-9 PFAM
Blast:ZnF_C2H2 1966 1991 6e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2502 2540 N/A INTRINSIC
low complexity region 2725 2735 N/A INTRINSIC
low complexity region 2818 2852 N/A INTRINSIC
low complexity region 2887 2905 N/A INTRINSIC
low complexity region 2928 2942 N/A INTRINSIC
low complexity region 2945 2959 N/A INTRINSIC
low complexity region 2966 2986 N/A INTRINSIC
low complexity region 3063 3091 N/A INTRINSIC
low complexity region 3329 3385 N/A INTRINSIC
low complexity region 3776 3788 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4364 5160 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129949
SMART Domains Protein: ENSMUSP00000115711
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:zf-UBR 372 437 2.1e-10 PFAM
Blast:ZnF_C2H2 678 703 5e-8 BLAST
low complexity region 980 991 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1448 1458 N/A INTRINSIC
low complexity region 1575 1593 N/A INTRINSIC
low complexity region 1616 1630 N/A INTRINSIC
low complexity region 1633 1647 N/A INTRINSIC
low complexity region 1654 1674 N/A INTRINSIC
low complexity region 1751 1779 N/A INTRINSIC
low complexity region 2017 2045 N/A INTRINSIC
low complexity region 2048 2065 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000147999
AA Change: I383N
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036
AA Change: I383N

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165860
AA Change: I3518N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036
AA Change: I3518N

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1659 1729 4e-13 PFAM
Blast:ZnF_C2H2 1966 1991 5e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2513 2551 N/A INTRINSIC
low complexity region 2736 2746 N/A INTRINSIC
low complexity region 2863 2881 N/A INTRINSIC
low complexity region 2904 2918 N/A INTRINSIC
low complexity region 2921 2935 N/A INTRINSIC
low complexity region 2942 2962 N/A INTRINSIC
low complexity region 3039 3067 N/A INTRINSIC
low complexity region 3305 3361 N/A INTRINSIC
low complexity region 3752 3764 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4340 5136 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik T A 13: 61,001,647 (GRCm39) M58L probably benign Het
Abca8b A G 11: 109,840,939 (GRCm39) V1078A probably benign Het
Acvr2b A G 9: 119,257,492 (GRCm39) D175G probably damaging Het
Adad2 A G 8: 120,339,769 (GRCm39) M84V probably benign Het
Ahnak A T 19: 8,994,411 (GRCm39) M5232L probably benign Het
Ahsa1 T C 12: 87,315,053 (GRCm39) S69P probably damaging Het
Aipl1 C T 11: 71,928,253 (GRCm39) G11D probably damaging Het
Antxr2 G T 5: 98,086,306 (GRCm39) P434T probably damaging Het
Arap1 T C 7: 101,037,382 (GRCm39) Y470H probably damaging Het
Baz1a A G 12: 54,963,372 (GRCm39) I907T probably damaging Het
Baz1b A T 5: 135,246,729 (GRCm39) Q726L probably benign Het
Bcar3 C T 3: 122,298,462 (GRCm39) probably benign Het
Bean1 C T 8: 104,908,739 (GRCm39) R39C probably damaging Het
Cass4 A T 2: 172,268,686 (GRCm39) N256I possibly damaging Het
Cnot10 T C 9: 114,460,897 (GRCm39) K91R probably benign Het
Col6a6 C T 9: 105,651,757 (GRCm39) V1085M probably damaging Het
Dpf3 A G 12: 83,534,449 (GRCm39) probably null Het
Dync1i2 T A 2: 71,093,019 (GRCm39) W605R probably damaging Het
Exoc5 A T 14: 49,286,297 (GRCm39) V110E probably damaging Het
Fgfr2 T A 7: 129,782,136 (GRCm39) H563L probably damaging Het
Fosl2 A G 5: 32,304,379 (GRCm39) T105A probably benign Het
Fsip2 A G 2: 82,818,604 (GRCm39) H4779R possibly damaging Het
Fuca2 A G 10: 13,382,518 (GRCm39) Y268C probably damaging Het
Galnt13 G A 2: 54,770,161 (GRCm39) E318K probably damaging Het
Hc G A 2: 34,876,294 (GRCm39) T1584I probably damaging Het
Helb T C 10: 119,928,556 (GRCm39) K762E probably damaging Het
Hspg2 T G 4: 137,296,827 (GRCm39) L4335R probably damaging Het
Ift88 A C 14: 57,718,920 (GRCm39) Q635P probably damaging Het
Inpp5a C A 7: 138,969,380 (GRCm39) D25E probably benign Het
Kcnu1 A G 8: 26,376,786 (GRCm39) T387A possibly damaging Het
Lamb1 G A 12: 31,374,223 (GRCm39) D1529N probably benign Het
Lamb1 A T 12: 31,374,224 (GRCm39) D1529V probably benign Het
Lnx1 T C 5: 74,758,584 (GRCm39) N476S probably benign Het
Mup17 T C 4: 61,512,633 (GRCm39) M87V probably benign Het
Naip6 G A 13: 100,452,494 (GRCm39) T189I probably damaging Het
Nf1 T A 11: 79,447,629 (GRCm39) Y462N possibly damaging Het
Nup133 T C 8: 124,664,881 (GRCm39) D270G probably benign Het
Obox2 T C 7: 15,130,789 (GRCm39) L7S probably damaging Het
Obox6 A T 7: 15,567,722 (GRCm39) S242T possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,236,850 (GRCm39) probably benign Het
Pigyl C T 9: 22,069,130 (GRCm39) probably benign Het
Rasa1 A G 13: 85,369,649 (GRCm39) V891A probably damaging Het
Rxrg A G 1: 167,458,890 (GRCm39) D292G possibly damaging Het
Saal1 A G 7: 46,351,248 (GRCm39) F243L probably benign Het
Sec24c G A 14: 20,729,598 (GRCm39) V59M probably benign Het
Sema4f C A 6: 82,890,890 (GRCm39) G639V probably damaging Het
Serpinb1c A T 13: 33,066,172 (GRCm39) C258S probably benign Het
Snx21 CACCTGCAGGCAGTGCCAGAGCTACGCCAAGCTCCGGACCTGCAGG CACCTGCAGG 2: 164,633,849 (GRCm39) probably benign Het
Syndig1 T C 2: 149,845,175 (GRCm39) S233P probably damaging Het
Taf6l A T 19: 8,752,636 (GRCm39) L377M probably damaging Het
Tcl1 T C 12: 105,184,979 (GRCm39) Y77C probably damaging Het
Tekt2 C A 4: 126,216,952 (GRCm39) M272I probably benign Het
Trp53bp1 T C 2: 121,100,460 (GRCm39) E98G probably benign Het
Wdr89 G T 12: 75,679,937 (GRCm39) P106T probably benign Het
Zfp534 T C 4: 147,758,698 (GRCm39) E657G possibly damaging Het
Zfp69 T C 4: 120,788,013 (GRCm39) K434R probably damaging Het
Zfyve26 T A 12: 79,321,680 (GRCm39) K980* probably null Het
Other mutations in Ubr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ubr4 APN 4 139,192,633 (GRCm39) missense possibly damaging 0.46
IGL00336:Ubr4 APN 4 139,155,877 (GRCm39) missense probably damaging 1.00
IGL00586:Ubr4 APN 4 139,182,495 (GRCm39) missense possibly damaging 0.95
IGL00659:Ubr4 APN 4 139,148,556 (GRCm39) missense probably damaging 1.00
IGL00766:Ubr4 APN 4 139,168,077 (GRCm39) missense probably damaging 1.00
IGL00819:Ubr4 APN 4 139,203,593 (GRCm39) missense possibly damaging 0.92
IGL00833:Ubr4 APN 4 139,120,470 (GRCm39) critical splice donor site probably null
IGL01126:Ubr4 APN 4 139,129,866 (GRCm39) missense probably benign 0.04
IGL01311:Ubr4 APN 4 139,206,356 (GRCm39) missense possibly damaging 0.66
IGL01349:Ubr4 APN 4 139,208,039 (GRCm39) missense unknown
IGL01388:Ubr4 APN 4 139,187,554 (GRCm39) missense possibly damaging 0.76
IGL01417:Ubr4 APN 4 139,138,111 (GRCm39) missense probably damaging 0.99
IGL01446:Ubr4 APN 4 139,165,351 (GRCm39) splice site probably benign
IGL01449:Ubr4 APN 4 139,140,047 (GRCm39) missense probably damaging 0.98
IGL01545:Ubr4 APN 4 139,170,140 (GRCm39) splice site probably benign
IGL01568:Ubr4 APN 4 139,148,684 (GRCm39) missense probably damaging 1.00
IGL01596:Ubr4 APN 4 139,189,845 (GRCm39) splice site probably benign
IGL01621:Ubr4 APN 4 139,168,094 (GRCm39) nonsense probably null
IGL01639:Ubr4 APN 4 139,144,655 (GRCm39) missense probably damaging 0.99
IGL01655:Ubr4 APN 4 139,135,107 (GRCm39) missense probably damaging 1.00
IGL01710:Ubr4 APN 4 139,145,772 (GRCm39) missense possibly damaging 0.81
IGL01830:Ubr4 APN 4 139,199,811 (GRCm39) missense probably damaging 0.99
IGL01862:Ubr4 APN 4 139,204,469 (GRCm39) missense possibly damaging 0.66
IGL01868:Ubr4 APN 4 139,139,989 (GRCm39) nonsense probably null
IGL01874:Ubr4 APN 4 139,120,600 (GRCm39) splice site probably benign
IGL01889:Ubr4 APN 4 139,189,783 (GRCm39) nonsense probably null
IGL01891:Ubr4 APN 4 139,163,571 (GRCm39) critical splice donor site probably null
IGL01980:Ubr4 APN 4 139,156,913 (GRCm39) missense probably damaging 0.99
IGL02126:Ubr4 APN 4 139,180,052 (GRCm39) critical splice donor site probably null
IGL02153:Ubr4 APN 4 139,187,471 (GRCm39) nonsense probably null
IGL02173:Ubr4 APN 4 139,164,381 (GRCm39) splice site probably null
IGL02214:Ubr4 APN 4 139,155,894 (GRCm39) missense possibly damaging 0.95
IGL02214:Ubr4 APN 4 139,189,138 (GRCm39) critical splice acceptor site probably null
IGL02220:Ubr4 APN 4 139,115,746 (GRCm39) missense probably benign 0.01
IGL02246:Ubr4 APN 4 139,186,414 (GRCm39) missense possibly damaging 0.89
IGL02264:Ubr4 APN 4 139,182,939 (GRCm39) nonsense probably null
IGL02273:Ubr4 APN 4 139,199,889 (GRCm39) missense possibly damaging 0.94
IGL02316:Ubr4 APN 4 139,200,489 (GRCm39) missense possibly damaging 0.46
IGL02328:Ubr4 APN 4 139,206,233 (GRCm39) missense probably damaging 0.97
IGL02476:Ubr4 APN 4 139,148,560 (GRCm39) nonsense probably null
IGL02477:Ubr4 APN 4 139,163,516 (GRCm39) missense probably damaging 0.98
IGL02544:Ubr4 APN 4 139,142,429 (GRCm39) missense probably damaging 1.00
IGL02622:Ubr4 APN 4 139,194,561 (GRCm39) nonsense probably null
IGL02679:Ubr4 APN 4 139,186,445 (GRCm39) missense probably damaging 0.99
IGL02728:Ubr4 APN 4 139,196,122 (GRCm39) missense probably damaging 1.00
IGL02754:Ubr4 APN 4 139,138,095 (GRCm39) missense probably damaging 0.99
IGL02754:Ubr4 APN 4 139,120,470 (GRCm39) critical splice donor site probably null
IGL02892:Ubr4 APN 4 139,144,642 (GRCm39) missense probably damaging 0.96
IGL02897:Ubr4 APN 4 139,199,819 (GRCm39) missense probably damaging 0.97
IGL02946:Ubr4 APN 4 139,152,606 (GRCm39) missense probably damaging 1.00
IGL02964:Ubr4 APN 4 139,135,131 (GRCm39) missense possibly damaging 0.84
IGL03059:Ubr4 APN 4 139,207,987 (GRCm39) missense probably damaging 0.98
IGL03068:Ubr4 APN 4 139,137,041 (GRCm39) missense probably benign 0.02
IGL03087:Ubr4 APN 4 139,177,668 (GRCm39) nonsense probably null
IGL03116:Ubr4 APN 4 139,206,892 (GRCm39) splice site probably benign
IGL03212:Ubr4 APN 4 139,137,074 (GRCm39) missense probably benign 0.13
IGL03228:Ubr4 APN 4 139,156,909 (GRCm39) missense probably damaging 1.00
IGL03292:Ubr4 APN 4 139,167,746 (GRCm39) missense probably damaging 1.00
IGL03388:Ubr4 APN 4 139,142,343 (GRCm39) missense probably damaging 0.98
IGL03393:Ubr4 APN 4 139,179,989 (GRCm39) missense probably damaging 1.00
IGL03409:Ubr4 APN 4 139,127,240 (GRCm39) nonsense probably null
Aqua_regia UTSW 4 139,180,030 (GRCm39) nonsense probably null
Eats UTSW 4 139,190,886 (GRCm39) missense probably damaging 0.97
Hardened UTSW 4 139,196,158 (GRCm39) missense probably damaging 1.00
Stoney UTSW 4 139,171,998 (GRCm39) missense probably damaging 1.00
Uber UTSW 4 139,206,373 (GRCm39) critical splice donor site probably null
BB001:Ubr4 UTSW 4 139,194,587 (GRCm39) missense unknown
BB011:Ubr4 UTSW 4 139,194,587 (GRCm39) missense unknown
P0019:Ubr4 UTSW 4 139,179,092 (GRCm39) missense probably damaging 1.00
PIT4544001:Ubr4 UTSW 4 139,129,871 (GRCm39) missense possibly damaging 0.93
R0001:Ubr4 UTSW 4 139,179,099 (GRCm39) missense probably damaging 1.00
R0002:Ubr4 UTSW 4 139,118,211 (GRCm39) missense probably damaging 1.00
R0006:Ubr4 UTSW 4 139,158,960 (GRCm39) missense probably benign 0.03
R0006:Ubr4 UTSW 4 139,158,960 (GRCm39) missense probably benign 0.03
R0008:Ubr4 UTSW 4 139,157,487 (GRCm39) missense probably damaging 1.00
R0027:Ubr4 UTSW 4 139,127,704 (GRCm39) missense probably damaging 0.99
R0027:Ubr4 UTSW 4 139,127,704 (GRCm39) missense probably damaging 0.99
R0030:Ubr4 UTSW 4 139,154,104 (GRCm39) missense probably damaging 1.00
R0044:Ubr4 UTSW 4 139,164,369 (GRCm39) splice site probably benign
R0044:Ubr4 UTSW 4 139,164,369 (GRCm39) splice site probably benign
R0088:Ubr4 UTSW 4 139,168,125 (GRCm39) missense probably damaging 1.00
R0131:Ubr4 UTSW 4 139,191,362 (GRCm39) missense possibly damaging 0.66
R0184:Ubr4 UTSW 4 139,172,573 (GRCm39) missense probably damaging 1.00
R0219:Ubr4 UTSW 4 139,157,568 (GRCm39) missense possibly damaging 0.64
R0227:Ubr4 UTSW 4 139,158,960 (GRCm39) missense probably benign 0.03
R0270:Ubr4 UTSW 4 139,206,746 (GRCm39) splice site probably benign
R0285:Ubr4 UTSW 4 139,168,112 (GRCm39) missense probably damaging 1.00
R0322:Ubr4 UTSW 4 139,149,729 (GRCm39) missense probably damaging 1.00
R0363:Ubr4 UTSW 4 139,119,171 (GRCm39) missense probably damaging 0.98
R0393:Ubr4 UTSW 4 139,138,171 (GRCm39) splice site probably benign
R0450:Ubr4 UTSW 4 139,157,534 (GRCm39) missense probably benign 0.14
R0504:Ubr4 UTSW 4 139,133,889 (GRCm39) missense probably damaging 1.00
R0504:Ubr4 UTSW 4 139,208,149 (GRCm39) critical splice donor site probably null
R0510:Ubr4 UTSW 4 139,157,534 (GRCm39) missense probably benign 0.14
R0513:Ubr4 UTSW 4 139,144,186 (GRCm39) missense possibly damaging 0.74
R0517:Ubr4 UTSW 4 139,119,435 (GRCm39) missense probably benign 0.00
R0558:Ubr4 UTSW 4 139,154,213 (GRCm39) missense probably benign 0.09
R0617:Ubr4 UTSW 4 139,206,373 (GRCm39) critical splice donor site probably null
R0636:Ubr4 UTSW 4 139,163,613 (GRCm39) splice site probably null
R0637:Ubr4 UTSW 4 139,126,926 (GRCm39) missense probably damaging 1.00
R0652:Ubr4 UTSW 4 139,128,637 (GRCm39) missense probably damaging 0.99
R0691:Ubr4 UTSW 4 139,151,217 (GRCm39) missense probably damaging 1.00
R0729:Ubr4 UTSW 4 139,212,631 (GRCm39) missense possibly damaging 0.66
R0735:Ubr4 UTSW 4 139,155,339 (GRCm39) splice site probably null
R0751:Ubr4 UTSW 4 139,164,509 (GRCm39) splice site probably benign
R0789:Ubr4 UTSW 4 139,137,582 (GRCm39) critical splice donor site probably null
R0825:Ubr4 UTSW 4 139,206,887 (GRCm39) critical splice donor site probably null
R0828:Ubr4 UTSW 4 139,177,864 (GRCm39) splice site probably benign
R1052:Ubr4 UTSW 4 139,182,771 (GRCm39) missense possibly damaging 0.83
R1184:Ubr4 UTSW 4 139,164,509 (GRCm39) splice site probably benign
R1222:Ubr4 UTSW 4 139,115,782 (GRCm39) splice site probably null
R1258:Ubr4 UTSW 4 139,154,225 (GRCm39) missense probably damaging 1.00
R1321:Ubr4 UTSW 4 139,187,434 (GRCm39) missense possibly damaging 0.46
R1385:Ubr4 UTSW 4 139,129,923 (GRCm39) missense probably benign 0.00
R1450:Ubr4 UTSW 4 139,195,339 (GRCm39) missense probably damaging 1.00
R1470:Ubr4 UTSW 4 139,148,537 (GRCm39) splice site probably null
R1470:Ubr4 UTSW 4 139,148,537 (GRCm39) splice site probably null
R1474:Ubr4 UTSW 4 139,156,890 (GRCm39) missense probably damaging 1.00
R1479:Ubr4 UTSW 4 139,153,151 (GRCm39) missense possibly damaging 0.95
R1534:Ubr4 UTSW 4 139,155,462 (GRCm39) missense possibly damaging 0.95
R1546:Ubr4 UTSW 4 139,144,238 (GRCm39) nonsense probably null
R1785:Ubr4 UTSW 4 139,151,256 (GRCm39) missense probably damaging 1.00
R1786:Ubr4 UTSW 4 139,151,256 (GRCm39) missense probably damaging 1.00
R1789:Ubr4 UTSW 4 139,120,364 (GRCm39) missense probably damaging 1.00
R1796:Ubr4 UTSW 4 139,155,907 (GRCm39) missense probably benign 0.25
R1800:Ubr4 UTSW 4 139,135,274 (GRCm39) missense probably damaging 0.99
R1801:Ubr4 UTSW 4 139,179,874 (GRCm39) splice site probably null
R1827:Ubr4 UTSW 4 139,153,008 (GRCm39) critical splice acceptor site probably null
R1887:Ubr4 UTSW 4 139,182,871 (GRCm39) missense probably damaging 1.00
R1966:Ubr4 UTSW 4 139,178,555 (GRCm39) critical splice acceptor site probably null
R2010:Ubr4 UTSW 4 139,207,963 (GRCm39) missense possibly damaging 0.92
R2049:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2069:Ubr4 UTSW 4 139,206,851 (GRCm39) missense possibly damaging 0.66
R2114:Ubr4 UTSW 4 139,156,922 (GRCm39) nonsense probably null
R2140:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2141:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2142:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2168:Ubr4 UTSW 4 139,137,960 (GRCm39) missense probably benign 0.25
R2237:Ubr4 UTSW 4 139,170,101 (GRCm39) missense probably damaging 1.00
R2249:Ubr4 UTSW 4 139,176,232 (GRCm39) missense probably damaging 1.00
R2261:Ubr4 UTSW 4 139,140,773 (GRCm39) missense probably damaging 0.99
R2264:Ubr4 UTSW 4 139,147,684 (GRCm39) splice site probably benign
R2353:Ubr4 UTSW 4 139,160,984 (GRCm39) missense possibly damaging 0.48
R2437:Ubr4 UTSW 4 139,200,853 (GRCm39) missense possibly damaging 0.90
R2496:Ubr4 UTSW 4 139,200,516 (GRCm39) unclassified probably benign
R2896:Ubr4 UTSW 4 139,182,955 (GRCm39) splice site probably null
R2922:Ubr4 UTSW 4 139,206,811 (GRCm39) missense possibly damaging 0.66
R2972:Ubr4 UTSW 4 139,133,847 (GRCm39) missense probably benign 0.22
R2973:Ubr4 UTSW 4 139,133,847 (GRCm39) missense probably benign 0.22
R2989:Ubr4 UTSW 4 139,190,869 (GRCm39) missense possibly damaging 0.89
R3176:Ubr4 UTSW 4 139,149,166 (GRCm39) missense probably benign 0.03
R3276:Ubr4 UTSW 4 139,149,166 (GRCm39) missense probably benign 0.03
R3772:Ubr4 UTSW 4 139,180,011 (GRCm39) missense possibly damaging 0.89
R3844:Ubr4 UTSW 4 139,186,437 (GRCm39) missense probably damaging 0.99
R3873:Ubr4 UTSW 4 139,151,301 (GRCm39) missense probably damaging 1.00
R3900:Ubr4 UTSW 4 139,206,373 (GRCm39) critical splice donor site probably null
R3951:Ubr4 UTSW 4 139,120,405 (GRCm39) missense probably damaging 1.00
R4020:Ubr4 UTSW 4 139,179,116 (GRCm39) missense probably damaging 0.98
R4178:Ubr4 UTSW 4 139,120,725 (GRCm39) missense probably damaging 1.00
R4308:Ubr4 UTSW 4 139,199,820 (GRCm39) missense possibly damaging 0.46
R4378:Ubr4 UTSW 4 139,137,751 (GRCm39) missense possibly damaging 0.76
R4400:Ubr4 UTSW 4 139,189,167 (GRCm39) missense possibly damaging 0.66
R4421:Ubr4 UTSW 4 139,189,167 (GRCm39) missense possibly damaging 0.66
R4462:Ubr4 UTSW 4 139,145,813 (GRCm39) missense possibly damaging 0.47
R4583:Ubr4 UTSW 4 139,108,164 (GRCm39) missense possibly damaging 0.82
R4611:Ubr4 UTSW 4 139,126,890 (GRCm39) missense possibly damaging 0.93
R4664:Ubr4 UTSW 4 139,133,829 (GRCm39) missense possibly damaging 0.56
R4671:Ubr4 UTSW 4 139,163,502 (GRCm39) missense possibly damaging 0.66
R4672:Ubr4 UTSW 4 139,138,027 (GRCm39) missense probably damaging 0.99
R4673:Ubr4 UTSW 4 139,138,027 (GRCm39) missense probably damaging 0.99
R4696:Ubr4 UTSW 4 139,135,983 (GRCm39) missense probably benign 0.09
R4701:Ubr4 UTSW 4 139,198,647 (GRCm39) missense possibly damaging 0.66
R4705:Ubr4 UTSW 4 139,177,840 (GRCm39) missense probably damaging 1.00
R4726:Ubr4 UTSW 4 139,209,890 (GRCm39) missense possibly damaging 0.46
R4728:Ubr4 UTSW 4 139,151,190 (GRCm39) missense probably damaging 1.00
R4783:Ubr4 UTSW 4 139,149,044 (GRCm39) missense possibly damaging 0.85
R4833:Ubr4 UTSW 4 139,129,857 (GRCm39) missense probably damaging 0.98
R4892:Ubr4 UTSW 4 139,155,828 (GRCm39) missense probably benign 0.14
R4936:Ubr4 UTSW 4 139,123,877 (GRCm39) missense probably damaging 0.98
R5000:Ubr4 UTSW 4 139,163,480 (GRCm39) missense probably damaging 0.98
R5114:Ubr4 UTSW 4 139,137,934 (GRCm39) missense probably damaging 0.99
R5189:Ubr4 UTSW 4 139,137,960 (GRCm39) missense probably benign 0.25
R5197:Ubr4 UTSW 4 139,195,408 (GRCm39) missense probably damaging 1.00
R5213:Ubr4 UTSW 4 139,129,877 (GRCm39) nonsense probably null
R5219:Ubr4 UTSW 4 139,204,543 (GRCm39) nonsense probably null
R5346:Ubr4 UTSW 4 139,155,802 (GRCm39) missense probably damaging 0.97
R5368:Ubr4 UTSW 4 139,124,839 (GRCm39) intron probably benign
R5442:Ubr4 UTSW 4 139,135,083 (GRCm39) missense probably damaging 1.00
R5527:Ubr4 UTSW 4 139,208,099 (GRCm39) missense possibly damaging 0.83
R5548:Ubr4 UTSW 4 139,187,401 (GRCm39) missense probably damaging 0.97
R5568:Ubr4 UTSW 4 139,119,349 (GRCm39) missense probably damaging 0.99
R5639:Ubr4 UTSW 4 139,179,959 (GRCm39) missense possibly damaging 0.66
R5643:Ubr4 UTSW 4 139,171,998 (GRCm39) missense probably damaging 1.00
R5663:Ubr4 UTSW 4 139,155,894 (GRCm39) missense possibly damaging 0.95
R5755:Ubr4 UTSW 4 139,187,406 (GRCm39) missense possibly damaging 0.66
R5781:Ubr4 UTSW 4 139,195,407 (GRCm39) missense probably damaging 1.00
R5784:Ubr4 UTSW 4 139,152,529 (GRCm39) missense probably damaging 1.00
R5817:Ubr4 UTSW 4 139,196,158 (GRCm39) missense probably damaging 1.00
R5872:Ubr4 UTSW 4 139,152,641 (GRCm39) missense probably damaging 0.98
R5891:Ubr4 UTSW 4 139,135,937 (GRCm39) nonsense probably null
R5901:Ubr4 UTSW 4 139,178,565 (GRCm39) missense probably damaging 1.00
R5958:Ubr4 UTSW 4 139,182,949 (GRCm39) missense probably damaging 1.00
R5974:Ubr4 UTSW 4 139,148,389 (GRCm39) splice site probably null
R6065:Ubr4 UTSW 4 139,148,549 (GRCm39) missense probably damaging 1.00
R6109:Ubr4 UTSW 4 139,144,675 (GRCm39) missense probably damaging 0.99
R6207:Ubr4 UTSW 4 139,148,559 (GRCm39) missense probably damaging 1.00
R6265:Ubr4 UTSW 4 139,179,951 (GRCm39) missense possibly damaging 0.90
R6319:Ubr4 UTSW 4 139,136,200 (GRCm39) missense possibly damaging 0.84
R6342:Ubr4 UTSW 4 139,156,850 (GRCm39) missense possibly damaging 0.88
R6434:Ubr4 UTSW 4 139,156,949 (GRCm39) missense probably damaging 1.00
R6437:Ubr4 UTSW 4 139,124,525 (GRCm39) critical splice donor site probably null
R6481:Ubr4 UTSW 4 139,159,062 (GRCm39) missense probably damaging 0.97
R6502:Ubr4 UTSW 4 139,171,982 (GRCm39) missense probably damaging 1.00
R6546:Ubr4 UTSW 4 139,141,705 (GRCm39) missense probably damaging 0.99
R6603:Ubr4 UTSW 4 139,182,897 (GRCm39) missense probably benign 0.17
R6648:Ubr4 UTSW 4 139,180,030 (GRCm39) nonsense probably null
R6649:Ubr4 UTSW 4 139,200,935 (GRCm39) missense possibly damaging 0.66
R6653:Ubr4 UTSW 4 139,200,935 (GRCm39) missense possibly damaging 0.66
R6668:Ubr4 UTSW 4 139,192,652 (GRCm39) missense probably damaging 1.00
R6770:Ubr4 UTSW 4 139,216,493 (GRCm39) missense unknown
R6772:Ubr4 UTSW 4 139,194,541 (GRCm39) nonsense probably null
R6857:Ubr4 UTSW 4 139,213,362 (GRCm39) missense possibly damaging 0.90
R6869:Ubr4 UTSW 4 139,194,538 (GRCm39) missense possibly damaging 0.93
R6912:Ubr4 UTSW 4 139,185,545 (GRCm39) critical splice donor site probably null
R6943:Ubr4 UTSW 4 139,164,442 (GRCm39) nonsense probably null
R6970:Ubr4 UTSW 4 139,133,839 (GRCm39) nonsense probably null
R6976:Ubr4 UTSW 4 139,120,388 (GRCm39) missense probably damaging 0.98
R7000:Ubr4 UTSW 4 139,141,715 (GRCm39) missense probably damaging 1.00
R7017:Ubr4 UTSW 4 139,120,401 (GRCm39) missense probably damaging 0.99
R7165:Ubr4 UTSW 4 139,177,824 (GRCm39) missense
R7222:Ubr4 UTSW 4 139,190,684 (GRCm39) missense unknown
R7241:Ubr4 UTSW 4 139,170,725 (GRCm39) missense probably damaging 1.00
R7343:Ubr4 UTSW 4 139,140,749 (GRCm39) missense probably benign 0.09
R7367:Ubr4 UTSW 4 139,180,002 (GRCm39) missense unknown
R7393:Ubr4 UTSW 4 139,154,096 (GRCm39) missense probably damaging 1.00
R7432:Ubr4 UTSW 4 139,115,693 (GRCm39) missense probably damaging 1.00
R7448:Ubr4 UTSW 4 139,189,778 (GRCm39) missense unknown
R7502:Ubr4 UTSW 4 139,139,983 (GRCm39) missense possibly damaging 0.72
R7514:Ubr4 UTSW 4 139,179,966 (GRCm39) missense unknown
R7526:Ubr4 UTSW 4 139,149,728 (GRCm39) missense probably benign 0.00
R7529:Ubr4 UTSW 4 139,149,728 (GRCm39) missense probably benign 0.00
R7666:Ubr4 UTSW 4 139,140,791 (GRCm39) missense possibly damaging 0.81
R7699:Ubr4 UTSW 4 139,136,178 (GRCm39) nonsense probably null
R7700:Ubr4 UTSW 4 139,136,178 (GRCm39) nonsense probably null
R7726:Ubr4 UTSW 4 139,186,231 (GRCm39) missense unknown
R7753:Ubr4 UTSW 4 139,197,603 (GRCm39) missense unknown
R7810:Ubr4 UTSW 4 139,142,394 (GRCm39) missense
R7837:Ubr4 UTSW 4 139,120,462 (GRCm39) nonsense probably null
R7868:Ubr4 UTSW 4 139,187,344 (GRCm39) missense unknown
R7872:Ubr4 UTSW 4 139,120,373 (GRCm39) missense possibly damaging 0.94
R7887:Ubr4 UTSW 4 139,135,121 (GRCm39) missense probably damaging 0.99
R7924:Ubr4 UTSW 4 139,194,587 (GRCm39) missense unknown
R7980:Ubr4 UTSW 4 139,145,717 (GRCm39) missense
R7982:Ubr4 UTSW 4 139,155,519 (GRCm39) critical splice donor site probably null
R8005:Ubr4 UTSW 4 139,139,941 (GRCm39) missense probably damaging 0.98
R8054:Ubr4 UTSW 4 139,195,413 (GRCm39) missense unknown
R8094:Ubr4 UTSW 4 139,168,007 (GRCm39) missense probably damaging 0.97
R8151:Ubr4 UTSW 4 139,130,112 (GRCm39) missense probably damaging 0.97
R8183:Ubr4 UTSW 4 139,209,782 (GRCm39) missense unknown
R8252:Ubr4 UTSW 4 139,200,528 (GRCm39) missense unknown
R8505:Ubr4 UTSW 4 139,156,880 (GRCm39) missense
R8519:Ubr4 UTSW 4 139,143,958 (GRCm39) missense probably damaging 0.97
R8716:Ubr4 UTSW 4 139,196,164 (GRCm39) missense unknown
R8720:Ubr4 UTSW 4 139,208,149 (GRCm39) critical splice donor site probably null
R8749:Ubr4 UTSW 4 139,129,935 (GRCm39) missense probably damaging 0.98
R8768:Ubr4 UTSW 4 139,149,076 (GRCm39) missense
R8789:Ubr4 UTSW 4 139,137,494 (GRCm39) missense possibly damaging 0.76
R8879:Ubr4 UTSW 4 139,137,829 (GRCm39) missense probably benign 0.06
R8937:Ubr4 UTSW 4 139,190,886 (GRCm39) missense probably damaging 0.97
R9006:Ubr4 UTSW 4 139,172,003 (GRCm39) critical splice donor site probably null
R9116:Ubr4 UTSW 4 139,145,785 (GRCm39) missense
R9134:Ubr4 UTSW 4 139,127,755 (GRCm39) critical splice donor site probably null
R9251:Ubr4 UTSW 4 139,177,636 (GRCm39) missense
R9384:Ubr4 UTSW 4 139,194,631 (GRCm39) missense unknown
R9389:Ubr4 UTSW 4 139,153,235 (GRCm39) missense
R9393:Ubr4 UTSW 4 139,212,613 (GRCm39) missense unknown
R9531:Ubr4 UTSW 4 139,135,217 (GRCm39) missense probably benign 0.00
R9573:Ubr4 UTSW 4 139,148,450 (GRCm39) missense
R9604:Ubr4 UTSW 4 139,159,827 (GRCm39) critical splice donor site probably null
R9613:Ubr4 UTSW 4 139,149,073 (GRCm39) missense
R9623:Ubr4 UTSW 4 139,159,024 (GRCm39) missense probably benign 0.00
R9651:Ubr4 UTSW 4 139,206,859 (GRCm39) missense unknown
R9685:Ubr4 UTSW 4 139,191,341 (GRCm39) missense unknown
R9698:Ubr4 UTSW 4 139,167,975 (GRCm39) missense
R9700:Ubr4 UTSW 4 139,119,388 (GRCm39) missense probably damaging 0.97
R9727:Ubr4 UTSW 4 139,140,735 (GRCm39) missense probably damaging 0.98
R9766:Ubr4 UTSW 4 139,194,595 (GRCm39) missense unknown
T0975:Ubr4 UTSW 4 139,179,092 (GRCm39) missense probably damaging 1.00
X0028:Ubr4 UTSW 4 139,137,582 (GRCm39) critical splice donor site probably null
Z1176:Ubr4 UTSW 4 139,137,456 (GRCm39) missense probably damaging 1.00
Z1176:Ubr4 UTSW 4 139,129,971 (GRCm39) missense probably benign 0.04
Z1176:Ubr4 UTSW 4 139,127,696 (GRCm39) missense probably damaging 1.00
Z1177:Ubr4 UTSW 4 139,177,792 (GRCm39) missense
Z1186:Ubr4 UTSW 4 139,137,964 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCTGGTGTGTAACAATCCTGAG -3'
(R):5'- CCTGCACAGTTCGGTTGTTG -3'

Sequencing Primer
(F):5'- TGTAACAATCCTGAGGTGCC -3'
(R):5'- GTAGTACAGGTTGATCGTCCGC -3'
Posted On 2022-04-18