Incidental Mutation 'R9361:Ccdc33'
ID 708704
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Name coiled-coil domain containing 33
Synonyms LOC382077, 4930535E21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9361 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 58028677-58118823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 58117625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 106 (C106Y)
Ref Sequence ENSEMBL: ENSMUSP00000096279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098681] [ENSMUST00000098682] [ENSMUST00000128021] [ENSMUST00000136154] [ENSMUST00000215944]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098681
AA Change: C106Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000098682
AA Change: C106Y

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: C106Y

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128021
SMART Domains Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 87 8.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136154
SMART Domains Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 199 1.7e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215944
AA Change: C106Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik C T 8: 120,634,321 A12T unknown Het
2810474O19Rik T G 6: 149,326,634 S393A possibly damaging Het
4933402N22Rik C T 5: 11,920,679 T105M Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Aasdh T A 5: 76,882,378 T792S probably benign Het
Actl11 T A 9: 107,928,625 L49Q probably damaging Het
Adcy3 G T 12: 4,209,366 R881L possibly damaging Het
Alox15 T G 11: 70,350,853 K67N probably damaging Het
Amotl1 C T 9: 14,593,381 R177Q probably benign Het
Ankrd34c T A 9: 89,730,130 I53F probably damaging Het
Atp8b5 T A 4: 43,369,658 F932Y possibly damaging Het
Bckdk A G 7: 127,907,343 M281V probably benign Het
Celsr3 T A 9: 108,849,322 I3250N probably damaging Het
Ces1g A T 8: 93,335,018 probably null Het
Ces2b G A 8: 104,837,407 probably null Het
Clspn A T 4: 126,585,861 D1033V probably damaging Het
Cntln G T 4: 85,049,914 R790I probably benign Het
Cspg4 T C 9: 56,896,593 V1656A probably damaging Het
Dlgap1 A T 17: 70,761,264 D610V probably damaging Het
Eya4 C A 10: 23,109,867 G579W probably damaging Het
Fam46b G T 4: 133,486,150 A111S probably damaging Het
Fam83b T C 9: 76,492,794 I342M probably benign Het
Fhdc1 A C 3: 84,448,833 C435G probably damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Fras1 T G 5: 96,776,698 L3666R probably damaging Het
Gm11639 C T 11: 105,005,698 T4291I probably benign Het
Gm21560 T A 14: 6,218,262 H72L possibly damaging Het
Gtsf2 C T 15: 103,439,639 W148* probably null Het
Gucy2c T C 6: 136,737,431 K466E possibly damaging Het
Higd2a T A 13: 54,590,307 D14E probably benign Het
Hlcs C T 16: 94,138,940 V513M probably benign Het
Ido1 T C 8: 24,589,585 T148A probably benign Het
Ighv1-5 T A 12: 114,513,365 T106S probably damaging Het
Igkv4-92 T C 6: 68,755,106 T95A possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Larp4b T G 13: 9,149,901 F278V probably damaging Het
Lrch4 G A 5: 137,636,814 R225H probably damaging Het
Mapkbp1 T C 2: 120,014,771 Y378H probably benign Het
Nme9 T A 9: 99,459,722 C42S probably damaging Het
Olfr1380 A G 11: 49,564,476 K185R probably damaging Het
Pdlim2 T G 14: 70,164,741 T309P probably damaging Het
Prodh C T 16: 18,080,970 C207Y probably benign Het
Prom1 A T 5: 44,055,887 L168Q probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Shkbp1 T C 7: 27,352,067 Q189R probably benign Het
Skint4 T C 4: 112,143,824 L372S probably damaging Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Specc1 A T 11: 62,146,318 E699D probably benign Het
St5 A G 7: 109,527,784 S907P probably damaging Het
Syt6 C A 3: 103,575,363 probably benign Het
Tg A G 15: 66,685,397 E969G possibly damaging Het
Tie1 A C 4: 118,479,632 H632Q probably benign Het
Trappc12 A G 12: 28,746,418 W372R probably damaging Het
Trav7d-4 T C 14: 52,770,149 V33A probably damaging Het
Ugdh A T 5: 65,418,543 N324K probably damaging Het
Vmn2r79 G T 7: 87,003,614 probably null Het
Washc2 T C 6: 116,262,472 *1335Q probably null Het
Yme1l1 C T 2: 23,191,051 T445I possibly damaging Het
Zdhhc11 T C 13: 73,974,618 C158R probably damaging Het
Zfp128 T C 7: 12,890,437 L244P probably damaging Het
Zfp445 T A 9: 122,861,822 I103F probably damaging Het
Zfp980 A T 4: 145,701,429 T243S probably benign Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 58082048 missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58117214 splice site probably benign
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 58033672 missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R3899:Ccdc33 UTSW 9 58032917 missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4468:Ccdc33 UTSW 9 58069872 missense possibly damaging 0.67
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 splice site probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
R7655:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7868:Ccdc33 UTSW 9 58069091 missense probably benign
R8215:Ccdc33 UTSW 9 58032712 missense probably benign 0.18
R9139:Ccdc33 UTSW 9 58076559 missense probably benign 0.04
R9204:Ccdc33 UTSW 9 58031105 missense probably benign 0.33
R9280:Ccdc33 UTSW 9 58058266 missense probably benign
R9297:Ccdc33 UTSW 9 58086593 missense possibly damaging 0.85
R9318:Ccdc33 UTSW 9 58086593 missense possibly damaging 0.85
RF003:Ccdc33 UTSW 9 58058291 missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58117416 missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58118585 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TTGCCACAATAGCGGTACAG -3'
(R):5'- TATAGGCCTCCTCACTCTGGTG -3'

Sequencing Primer
(F):5'- CACAATAGCGGTACAGGTCTTCATG -3'
(R):5'- CTCACTCTGGTGGGGTCACATG -3'
Posted On 2022-04-18