Incidental Mutation 'R9573:Hyal4'
ID 722108
Institutional Source Beutler Lab
Gene Symbol Hyal4
Ensembl Gene ENSMUSG00000029680
Gene Name hyaluronoglucosaminidase 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9573 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 24748329-24767662 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24756509 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 242 (V242A)
Ref Sequence ENSEMBL: ENSMUSP00000031691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031691]
AlphaFold Q05A56
Predicted Effect possibly damaging
Transcript: ENSMUST00000031691
AA Change: V242A

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031691
Gene: ENSMUSG00000029680
AA Change: V242A

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Glyco_hydro_56 41 373 3e-137 PFAM
EGF 375 447 2.81e0 SMART
low complexity region 453 473 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar in structure to hyaluronidases. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. However, this protein has not yet been shown to have hyaluronidase activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,465,778 I548N probably damaging Het
Afdn T A 17: 13,829,967 V472E probably damaging Het
Ak3 T C 19: 29,026,267 I170V probably benign Het
Ank3 T A 10: 69,956,147 L1058* probably null Het
Ankrd60 A G 2: 173,568,998 V243A possibly damaging Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Arid3c T G 4: 41,726,003 E200A probably benign Het
Astn2 T G 4: 65,648,354 I856L probably benign Het
Bcs1l C A 1: 74,590,333 R177S probably damaging Het
Bin2 A T 15: 100,662,552 F43I probably damaging Het
Braf A G 6: 39,623,610 L691P probably damaging Het
Bud23 C T 5: 135,053,420 V266I possibly damaging Het
Casp12 A T 9: 5,354,629 I333L probably benign Het
Cavin2 T A 1: 51,289,636 I84N probably damaging Het
Cep170b T A 12: 112,724,720 F24I probably damaging Het
Chd9 A G 8: 90,977,674 Y719C unknown Het
Commd7 A G 2: 153,622,061 M137T probably damaging Het
Dmbt1 G A 7: 131,056,180 probably null Het
Dnah12 A C 14: 26,693,464 T7P probably benign Het
Endod1 A T 9: 14,380,951 L7Q probably damaging Het
Galnt14 C T 17: 73,495,667 V477M probably damaging Het
Glis2 C T 16: 4,611,641 R211C probably damaging Het
Gm3376 T A Y: 3,775,370 M40K possibly damaging Het
Gm340 T A 19: 41,585,032 L742Q probably damaging Het
Gm4744 A T 6: 40,948,563 V122D Het
Gm4952 G A 19: 12,626,726 M167I probably benign Het
Gm6657 A T 12: 78,197,324 N17I Het
Gm8251 A C 1: 44,056,147 Y1930* probably null Het
Ift122 T G 6: 115,880,685 S131A probably benign Het
Il4ra T A 7: 125,569,986 S137T possibly damaging Het
Lpin2 A G 17: 71,231,190 K315R probably benign Het
Map3k6 T C 4: 133,252,463 Y1258H probably damaging Het
Mapk9 A T 11: 49,878,412 K290N probably damaging Het
Mfhas1 C T 8: 35,676,749 H1045Y possibly damaging Het
Ndufaf7 C A 17: 78,938,607 Q90K probably damaging Het
Nlrc3 A T 16: 3,953,977 V157E probably benign Het
Npas4 A G 19: 4,985,809 F776L probably benign Het
Nuggc A C 14: 65,611,154 D184A probably benign Het
Ogdhl A G 14: 32,344,721 E795G probably damaging Het
Olfr459 T G 6: 41,772,006 I98L probably benign Het
Olfr76 A G 19: 12,120,145 I189T probably damaging Het
Pcbp1 A T 6: 86,525,695 M74K possibly damaging Het
Plk4 A G 3: 40,808,822 D476G probably benign Het
Prox2 G A 12: 85,094,992 Q146* probably null Het
Rab44 A T 17: 29,145,303 Y617F unknown Het
Rabepk T C 2: 34,785,615 R168G probably benign Het
Rif1 T G 2: 52,110,454 S1307A probably benign Het
Ror2 C T 13: 53,111,431 V542I probably benign Het
Rtp1 A G 16: 23,431,409 I175V possibly damaging Het
Slc11a2 T A 15: 100,406,344 I158F probably damaging Het
Slc24a3 T G 2: 145,613,628 M479R probably damaging Het
Slc4a9 T C 18: 36,535,536 F723S probably damaging Het
Syne2 C A 12: 75,880,360 N93K probably damaging Het
Sytl2 A G 7: 90,408,391 Q846R probably damaging Het
Tas2r116 A C 6: 132,856,177 H247P probably benign Het
Tcstv3 T C 13: 120,317,594 S10P probably damaging Het
Tgm7 T C 2: 121,104,125 N124S probably benign Het
Tmem219 A T 7: 126,891,761 Y175N probably damaging Het
Tnfrsf18 G A 4: 156,028,027 G114S possibly damaging Het
Trim38 G A 13: 23,782,705 C45Y probably benign Het
Tshz1 T C 18: 84,014,279 E668G probably benign Het
Ubr4 T A 4: 139,421,139 M382K Het
Vps39 T C 2: 120,324,698 E549G possibly damaging Het
Wdr35 G A 12: 9,028,014 G1135D probably benign Het
Zbtb46 A G 2: 181,411,755 L388P probably benign Het
Zdhhc25 T A 15: 88,601,104 M214K probably damaging Het
Zfp735 G A 11: 73,712,110 E627K possibly damaging Het
Other mutations in Hyal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Hyal4 APN 6 24755872 missense probably benign 0.03
IGL01791:Hyal4 APN 6 24763895 splice site probably benign
IGL02434:Hyal4 APN 6 24763858 nonsense probably null
IGL02523:Hyal4 APN 6 24765969 missense probably damaging 0.96
IGL03114:Hyal4 APN 6 24755965 missense probably benign 0.00
IGL02835:Hyal4 UTSW 6 24765715 missense probably benign 0.00
PIT4494001:Hyal4 UTSW 6 24755834 missense probably benign 0.05
R0196:Hyal4 UTSW 6 24756221 missense probably damaging 1.00
R0323:Hyal4 UTSW 6 24756194 missense probably benign 0.30
R0398:Hyal4 UTSW 6 24756671 missense probably damaging 0.97
R0946:Hyal4 UTSW 6 24755913 nonsense probably null
R0961:Hyal4 UTSW 6 24755746 utr 5 prime probably benign
R1906:Hyal4 UTSW 6 24756111 missense probably damaging 1.00
R1998:Hyal4 UTSW 6 24756311 missense probably benign 0.00
R2085:Hyal4 UTSW 6 24755750 start gained probably benign
R2483:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3622:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3623:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3624:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3712:Hyal4 UTSW 6 24756514 missense probably damaging 1.00
R4031:Hyal4 UTSW 6 24756224 missense probably damaging 1.00
R5762:Hyal4 UTSW 6 24765862 missense possibly damaging 0.93
R6177:Hyal4 UTSW 6 24766090 nonsense probably null
R6442:Hyal4 UTSW 6 24765850 missense probably benign 0.08
R6494:Hyal4 UTSW 6 24765746 missense possibly damaging 0.79
R6901:Hyal4 UTSW 6 24756191 missense probably damaging 0.97
R7565:Hyal4 UTSW 6 24765934 missense possibly damaging 0.77
R7973:Hyal4 UTSW 6 24755786 start codon destroyed probably null 0.99
R7977:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R7987:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R8020:Hyal4 UTSW 6 24755996 missense probably benign 0.14
R8676:Hyal4 UTSW 6 24755827 missense probably damaging 0.99
R9331:Hyal4 UTSW 6 24765867 missense probably damaging 1.00
Z1176:Hyal4 UTSW 6 24756628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCTGATATTGAATATTCAGCC -3'
(R):5'- AGGTTCCTCTTTGTAGCCCAG -3'

Sequencing Primer
(F):5'- GCTGATATTGAATATTCAGCCAAGGC -3'
(R):5'- TAGCCCAGCTGTGTGTAGACAAATAC -3'
Posted On 2022-08-09