Incidental Mutation 'R9573:Nuggc'
ID 722136
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Name nuclear GTPase, germinal center associated
Synonyms Gm600, SLIP-GC, LOC239151
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R9573 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 65598546-65648531 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 65611154 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 184 (D184A)
Ref Sequence ENSEMBL: ENSMUSP00000078434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
AlphaFold D3YWJ0
Predicted Effect probably benign
Transcript: ENSMUST00000079469
AA Change: D184A

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: D184A

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150897
AA Change: D168A

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: D168A

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,465,778 I548N probably damaging Het
Afdn T A 17: 13,829,967 V472E probably damaging Het
Ak3 T C 19: 29,026,267 I170V probably benign Het
Ank3 T A 10: 69,956,147 L1058* probably null Het
Ankrd60 A G 2: 173,568,998 V243A possibly damaging Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Arid3c T G 4: 41,726,003 E200A probably benign Het
Astn2 T G 4: 65,648,354 I856L probably benign Het
Bcs1l C A 1: 74,590,333 R177S probably damaging Het
Bin2 A T 15: 100,662,552 F43I probably damaging Het
Braf A G 6: 39,623,610 L691P probably damaging Het
Bud23 C T 5: 135,053,420 V266I possibly damaging Het
Casp12 A T 9: 5,354,629 I333L probably benign Het
Cavin2 T A 1: 51,289,636 I84N probably damaging Het
Cep170b T A 12: 112,724,720 F24I probably damaging Het
Chd9 A G 8: 90,977,674 Y719C unknown Het
Commd7 A G 2: 153,622,061 M137T probably damaging Het
Dmbt1 G A 7: 131,056,180 probably null Het
Dnah12 A C 14: 26,693,464 T7P probably benign Het
Endod1 A T 9: 14,380,951 L7Q probably damaging Het
Galnt14 C T 17: 73,495,667 V477M probably damaging Het
Glis2 C T 16: 4,611,641 R211C probably damaging Het
Gm3376 T A Y: 3,775,370 M40K possibly damaging Het
Gm340 T A 19: 41,585,032 L742Q probably damaging Het
Gm4744 A T 6: 40,948,563 V122D Het
Gm4952 G A 19: 12,626,726 M167I probably benign Het
Gm6657 A T 12: 78,197,324 N17I Het
Gm8251 A C 1: 44,056,147 Y1930* probably null Het
Hyal4 T C 6: 24,756,509 V242A possibly damaging Het
Ift122 T G 6: 115,880,685 S131A probably benign Het
Il4ra T A 7: 125,569,986 S137T possibly damaging Het
Lpin2 A G 17: 71,231,190 K315R probably benign Het
Map3k6 T C 4: 133,252,463 Y1258H probably damaging Het
Mapk9 A T 11: 49,878,412 K290N probably damaging Het
Mfhas1 C T 8: 35,676,749 H1045Y possibly damaging Het
Ndufaf7 C A 17: 78,938,607 Q90K probably damaging Het
Nlrc3 A T 16: 3,953,977 V157E probably benign Het
Npas4 A G 19: 4,985,809 F776L probably benign Het
Ogdhl A G 14: 32,344,721 E795G probably damaging Het
Olfr459 T G 6: 41,772,006 I98L probably benign Het
Olfr76 A G 19: 12,120,145 I189T probably damaging Het
Pcbp1 A T 6: 86,525,695 M74K possibly damaging Het
Plk4 A G 3: 40,808,822 D476G probably benign Het
Prox2 G A 12: 85,094,992 Q146* probably null Het
Rab44 A T 17: 29,145,303 Y617F unknown Het
Rabepk T C 2: 34,785,615 R168G probably benign Het
Rif1 T G 2: 52,110,454 S1307A probably benign Het
Ror2 C T 13: 53,111,431 V542I probably benign Het
Rtp1 A G 16: 23,431,409 I175V possibly damaging Het
Slc11a2 T A 15: 100,406,344 I158F probably damaging Het
Slc24a3 T G 2: 145,613,628 M479R probably damaging Het
Slc4a9 T C 18: 36,535,536 F723S probably damaging Het
Syne2 C A 12: 75,880,360 N93K probably damaging Het
Sytl2 A G 7: 90,408,391 Q846R probably damaging Het
Tas2r116 A C 6: 132,856,177 H247P probably benign Het
Tcstv3 T C 13: 120,317,594 S10P probably damaging Het
Tgm7 T C 2: 121,104,125 N124S probably benign Het
Tmem219 A T 7: 126,891,761 Y175N probably damaging Het
Tnfrsf18 G A 4: 156,028,027 G114S possibly damaging Het
Trim38 G A 13: 23,782,705 C45Y probably benign Het
Tshz1 T C 18: 84,014,279 E668G probably benign Het
Ubr4 T A 4: 139,421,139 M382K Het
Vps39 T C 2: 120,324,698 E549G possibly damaging Het
Wdr35 G A 12: 9,028,014 G1135D probably benign Het
Zbtb46 A G 2: 181,411,755 L388P probably benign Het
Zdhhc25 T A 15: 88,601,104 M214K probably damaging Het
Zfp735 G A 11: 73,712,110 E627K possibly damaging Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65623207 missense probably damaging 1.00
IGL01403:Nuggc APN 14 65623186 missense probably benign 0.01
IGL01413:Nuggc APN 14 65638581 missense probably benign 0.23
IGL02588:Nuggc APN 14 65617777 splice site probably benign
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0395:Nuggc UTSW 14 65613472 nonsense probably null
R0827:Nuggc UTSW 14 65608891 missense probably damaging 1.00
R1496:Nuggc UTSW 14 65624133 missense probably damaging 0.96
R1861:Nuggc UTSW 14 65642001 splice site probably benign
R1986:Nuggc UTSW 14 65641921 missense probably damaging 0.98
R1995:Nuggc UTSW 14 65611174 missense probably benign 0.02
R2283:Nuggc UTSW 14 65638612 missense possibly damaging 0.89
R2317:Nuggc UTSW 14 65624142 missense possibly damaging 0.81
R3799:Nuggc UTSW 14 65619638 missense probably benign 0.00
R3980:Nuggc UTSW 14 65619093 critical splice donor site probably null
R4303:Nuggc UTSW 14 65611172 missense possibly damaging 0.77
R4431:Nuggc UTSW 14 65611210 missense probably benign 0.19
R4734:Nuggc UTSW 14 65623230 missense probably damaging 1.00
R5095:Nuggc UTSW 14 65635090 nonsense probably null
R5108:Nuggc UTSW 14 65638680 missense probably damaging 0.99
R5360:Nuggc UTSW 14 65638626 missense probably damaging 1.00
R5547:Nuggc UTSW 14 65641881 missense possibly damaging 0.87
R5636:Nuggc UTSW 14 65648188 nonsense probably null
R6494:Nuggc UTSW 14 65648222 missense probably damaging 1.00
R6922:Nuggc UTSW 14 65617643 missense probably damaging 1.00
R6971:Nuggc UTSW 14 65608856 missense probably benign 0.04
R7124:Nuggc UTSW 14 65608802 missense probably damaging 1.00
R7273:Nuggc UTSW 14 65619608 missense probably damaging 0.99
R7282:Nuggc UTSW 14 65617623 missense probably damaging 1.00
R7578:Nuggc UTSW 14 65648174 missense probably damaging 1.00
R7670:Nuggc UTSW 14 65613526 missense probably damaging 1.00
R7780:Nuggc UTSW 14 65645041 missense probably damaging 1.00
R7871:Nuggc UTSW 14 65623251 missense probably benign 0.01
R8250:Nuggc UTSW 14 65641869 missense probably benign 0.10
R8329:Nuggc UTSW 14 65641282 missense probably benign 0.01
R8334:Nuggc UTSW 14 65645029 missense probably benign 0.04
R8463:Nuggc UTSW 14 65613562 missense probably damaging 1.00
R8503:Nuggc UTSW 14 65641348 critical splice donor site probably null
R8737:Nuggc UTSW 14 65645086 missense probably benign 0.00
R8861:Nuggc UTSW 14 65610035 critical splice donor site probably null
R8914:Nuggc UTSW 14 65641905 missense probably benign
R9666:Nuggc UTSW 14 65619596 missense possibly damaging 0.86
R9792:Nuggc UTSW 14 65609896 missense probably damaging 1.00
R9793:Nuggc UTSW 14 65609896 missense probably damaging 1.00
R9795:Nuggc UTSW 14 65609896 missense probably damaging 1.00
RF019:Nuggc UTSW 14 65648264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGGACACTCATTTACAGG -3'
(R):5'- AGACATCTTGACGTTACCTCC -3'

Sequencing Primer
(F):5'- CTCATTTACAGGACAAGAGATTTGGG -3'
(R):5'- GTTCTCGAGTTGGGAATCCTCC -3'
Posted On 2022-08-09