Incidental Mutation 'R0826:Olfr1386'
List |< first << previous [record 41 of 66] next >> last >|
ID78247
Institutional Source Beutler Lab
Gene Symbol Olfr1386
Ensembl Gene ENSMUSG00000108167
Gene Nameolfactory receptor 1386
SynonymsGA_x6K02T2QP88-5964781-5963852, MOR256-50
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R0826 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49465046-49471715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49470331 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 60 (Y60F)
Ref Sequence ENSEMBL: ENSMUSP00000150448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071905] [ENSMUST00000204518] [ENSMUST00000213674]
Predicted Effect probably damaging
Transcript: ENSMUST00000071905
AA Change: Y60F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071801
Gene: ENSMUSG00000108167
AA Change: Y60F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.2e-5 PFAM
Pfam:7tm_1 41 289 7.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204518
AA Change: Y60F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145320
Gene: ENSMUSG00000108167
AA Change: Y60F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.2e-5 PFAM
Pfam:7tm_1 41 289 7.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213674
AA Change: Y60F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1493 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Olfr1386
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Olfr1386 APN 11 49471053 missense probably benign 0.00
IGL02698:Olfr1386 APN 11 49470863 missense probably benign 0.02
IGL02727:Olfr1386 APN 11 49471066 missense probably benign 0.04
R1512:Olfr1386 UTSW 11 49470459 missense probably benign 0.00
R1822:Olfr1386 UTSW 11 49470968 missense probably benign 0.03
R1942:Olfr1386 UTSW 11 49470154 start codon destroyed probably null 0.98
R2282:Olfr1386 UTSW 11 49470643 missense probably damaging 0.96
R4646:Olfr1386 UTSW 11 49470624 missense probably benign 0.00
R4762:Olfr1386 UTSW 11 49470285 missense probably damaging 1.00
R4892:Olfr1386 UTSW 11 49470216 missense probably benign 0.00
R4968:Olfr1386 UTSW 11 49470531 missense probably damaging 1.00
R6882:Olfr1386 UTSW 11 49470463 missense probably benign
R7107:Olfr1386 UTSW 11 49470434 nonsense probably null
R7300:Olfr1386 UTSW 11 49470646 missense probably benign 0.00
R7308:Olfr1386 UTSW 11 49469927 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCAAAGGGCCTGGTTCAGGAAATG -3'
(R):5'- TGGACGACACACAGCAGCATAG -3'

Sequencing Primer
(F):5'- TAGTGGGAACTAAGTTATCCCCCTG -3'
(R):5'- ACAGCAGCATAGCGGTC -3'
Posted On2013-10-16