Incidental Mutation 'R0880:Gucy2c'
ID80461
Institutional Source Beutler Lab
Gene Symbol Gucy2c
Ensembl Gene ENSMUSG00000042638
Gene Nameguanylate cyclase 2c
SynonymsGC-C
MMRRC Submission 039047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0880 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136697284-136781765 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 136709832 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032338] [ENSMUST00000078095]
Predicted Effect probably null
Transcript: ENSMUST00000032338
SMART Domains Protein: ENSMUSP00000032338
Gene: ENSMUSG00000042638

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 113 384 3.7e-8 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 498 744 3.4e-33 PFAM
Pfam:Pkinase 499 744 1e-26 PFAM
CYCc 787 982 2.68e-107 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078095
SMART Domains Protein: ENSMUSP00000077236
Gene: ENSMUSG00000042638

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 53 385 2.7e-41 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 475 720 6.5e-32 PFAM
Pfam:Pkinase 480 720 7.2e-25 PFAM
CYCc 763 958 2.68e-107 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as a receptor for endogenous peptides guanylin and uroguanylin, and the heat-stable E. coli enterotoxin. The encoded protein activates the cystic fibrosis transmembrane conductance regulator. Mutations in this gene are associated with familial diarrhea (autosomal dominant) and meconium ileus (autosomal recessive). [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous null mice are viable and have an increased resistance to heat-stable enterotoxins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,560,646 Y701H possibly damaging Het
A430078G23Rik A G 8: 3,389,032 probably benign Het
Akap6 A G 12: 53,139,508 D1235G possibly damaging Het
Astn2 A G 4: 65,648,330 Y812H probably damaging Het
B230118H07Rik T A 2: 101,576,110 T158S probably benign Het
Bmpr1b G T 3: 141,870,796 S92* probably null Het
Camsap2 T C 1: 136,280,970 D934G probably benign Het
Cdh23 A G 10: 60,406,421 V1076A possibly damaging Het
Cdhr1 T C 14: 37,080,634 D624G possibly damaging Het
Cfap57 A T 4: 118,581,838 Y830* probably null Het
Dgcr14 A G 16: 17,911,187 V40A probably damaging Het
Eml3 A G 19: 8,940,915 D790G possibly damaging Het
Helz2 A C 2: 181,236,135 S957A probably benign Het
Ifi209 T A 1: 173,644,813 S407T probably damaging Het
Muc6 T C 7: 141,637,357 T2403A possibly damaging Het
Nfe2 T C 15: 103,249,262 N101D probably damaging Het
Nsf A T 11: 103,913,372 V178D possibly damaging Het
P4ha3 A G 7: 100,305,909 T324A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Rhbdf1 T C 11: 32,213,432 probably null Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Speg T C 1: 75,405,061 F1024S probably damaging Het
Sspo A G 6: 48,475,935 N2859S possibly damaging Het
Tnfrsf21 G A 17: 43,037,842 W115* probably null Het
Other mutations in Gucy2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Gucy2c APN 6 136765614 missense probably benign 0.01
IGL01081:Gucy2c APN 6 136702739 missense probably damaging 1.00
IGL01285:Gucy2c APN 6 136709741 missense probably damaging 1.00
IGL01395:Gucy2c APN 6 136698029 missense probably damaging 1.00
IGL01408:Gucy2c APN 6 136698011 missense probably benign 0.19
IGL01752:Gucy2c APN 6 136770108 missense probably benign 0.10
IGL01766:Gucy2c APN 6 136715973 missense probably benign 0.43
IGL02245:Gucy2c APN 6 136729203 missense probably benign 0.00
IGL02648:Gucy2c APN 6 136729213 nonsense probably null
IGL02794:Gucy2c APN 6 136713148 missense probably damaging 1.00
IGL03023:Gucy2c APN 6 136702796 splice site probably null
IGL03178:Gucy2c APN 6 136729239 splice site probably benign
IGL03310:Gucy2c APN 6 136751046 missense probably benign
IGL03374:Gucy2c APN 6 136765630 missense probably benign 0.00
IGL03393:Gucy2c APN 6 136719667 missense probably benign 0.04
BB001:Gucy2c UTSW 6 136763055 missense probably benign 0.35
BB011:Gucy2c UTSW 6 136763055 missense probably benign 0.35
R0031:Gucy2c UTSW 6 136697999 missense probably damaging 0.99
R0128:Gucy2c UTSW 6 136704249 missense probably damaging 1.00
R0377:Gucy2c UTSW 6 136750917 critical splice donor site probably null
R0593:Gucy2c UTSW 6 136728335 missense probably damaging 0.99
R0613:Gucy2c UTSW 6 136760723 missense probably damaging 1.00
R0723:Gucy2c UTSW 6 136727801 splice site probably null
R0828:Gucy2c UTSW 6 136709748 missense probably damaging 1.00
R0837:Gucy2c UTSW 6 136722420 missense probably damaging 0.99
R1350:Gucy2c UTSW 6 136743914 critical splice donor site probably null
R1487:Gucy2c UTSW 6 136748826 missense possibly damaging 0.79
R1680:Gucy2c UTSW 6 136722493 missense probably damaging 1.00
R1751:Gucy2c UTSW 6 136748775 splice site probably benign
R1791:Gucy2c UTSW 6 136744027 missense probably damaging 1.00
R1953:Gucy2c UTSW 6 136704293 missense probably damaging 1.00
R2135:Gucy2c UTSW 6 136723728 missense probably damaging 1.00
R2227:Gucy2c UTSW 6 136702760 missense probably damaging 1.00
R2350:Gucy2c UTSW 6 136763074 missense probably damaging 0.98
R2906:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R2907:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R3699:Gucy2c UTSW 6 136770111 missense probably damaging 1.00
R3972:Gucy2c UTSW 6 136708366 missense probably damaging 1.00
R4613:Gucy2c UTSW 6 136708321 missense probably damaging 1.00
R4732:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4733:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4776:Gucy2c UTSW 6 136722514 missense probably damaging 1.00
R5087:Gucy2c UTSW 6 136767035 missense possibly damaging 0.69
R5284:Gucy2c UTSW 6 136763043 missense possibly damaging 0.56
R5366:Gucy2c UTSW 6 136720741 missense probably damaging 0.99
R5466:Gucy2c UTSW 6 136781465 nonsense probably null
R5911:Gucy2c UTSW 6 136722442 missense probably damaging 1.00
R6160:Gucy2c UTSW 6 136740686 nonsense probably null
R6367:Gucy2c UTSW 6 136709778 missense probably damaging 1.00
R6441:Gucy2c UTSW 6 136723761 missense probably damaging 0.98
R6812:Gucy2c UTSW 6 136697995 missense probably benign
R6865:Gucy2c UTSW 6 136770129 missense probably benign 0.13
R7065:Gucy2c UTSW 6 136720766 missense probably damaging 1.00
R7078:Gucy2c UTSW 6 136697939 missense probably benign 0.19
R7096:Gucy2c UTSW 6 136728341 missense probably benign 0.11
R7138:Gucy2c UTSW 6 136728344 missense probably damaging 1.00
R7343:Gucy2c UTSW 6 136702748 missense probably damaging 1.00
R7538:Gucy2c UTSW 6 136709744 missense probably damaging 1.00
R7587:Gucy2c UTSW 6 136704290 missense probably damaging 1.00
R7666:Gucy2c UTSW 6 136697968 missense probably benign
R7675:Gucy2c UTSW 6 136716032 missense possibly damaging 0.91
R7822:Gucy2c UTSW 6 136708406 missense probably damaging 1.00
R7842:Gucy2c UTSW 6 136769816 splice site probably null
R7924:Gucy2c UTSW 6 136763055 missense probably benign 0.35
R8078:Gucy2c UTSW 6 136697921 missense probably damaging 1.00
R8094:Gucy2c UTSW 6 136737448 missense probably benign 0.33
R8391:Gucy2c UTSW 6 136704215 missense probably damaging 1.00
Z1088:Gucy2c UTSW 6 136743981 missense probably benign
Z1177:Gucy2c UTSW 6 136719687 missense probably damaging 1.00
Z1177:Gucy2c UTSW 6 136767196 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATGTCGTTGAGCATGTCCACC -3'
(R):5'- TCAGCAACACACTTGACAGTGAGG -3'

Sequencing Primer
(F):5'- TGAGCATGTCCACCACCTC -3'
(R):5'- CACACTTGACAGTGAGGTTTCTG -3'
Posted On2013-11-07