Incidental Mutation 'R6925:Ercc6'
ID 541116
Institutional Source Beutler Lab
Gene Symbol Ercc6
Ensembl Gene ENSMUSG00000054051
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms CS group B correcting gene, C130058G22Rik, CSB
MMRRC Submission 045043-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.422) question?
Stock # R6925 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 32235478-32302947 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32284565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 776 (I776N)
Ref Sequence ENSEMBL: ENSMUSP00000066256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066807]
AlphaFold F8VPZ5
Predicted Effect probably damaging
Transcript: ENSMUST00000066807
AA Change: I776N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: I776N

DomainStartEndE-ValueType
PDB:4CVO|A 82 160 1e-36 PDB
low complexity region 286 299 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 460 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
DEXDc 499 699 8.34e-33 SMART
Blast:DEXDc 720 821 7e-56 BLAST
HELICc 865 948 1.41e-21 SMART
low complexity region 1364 1377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228549
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 A T 9: 53,503,329 (GRCm39) V170E probably benign Het
Atp2b2 T A 6: 113,737,681 (GRCm39) I902F probably damaging Het
Cacna1d A G 14: 29,773,594 (GRCm39) V1697A probably benign Het
Ccdc14 T A 16: 34,511,119 (GRCm39) F31Y probably benign Het
Ccdc17 T A 4: 116,455,407 (GRCm39) V250E probably damaging Het
Cct7 A G 6: 85,436,164 (GRCm39) N25S probably damaging Het
Cdcp3 A G 7: 130,824,436 (GRCm39) Q177R possibly damaging Het
Cep19 G C 16: 31,922,760 (GRCm39) G9R probably damaging Het
Ces5a A T 8: 94,249,685 (GRCm39) probably null Het
Chd1l T G 3: 97,490,142 (GRCm39) E471A probably damaging Het
Chd6 A G 2: 160,855,047 (GRCm39) I787T probably damaging Het
Cntnap5c A C 17: 58,702,261 (GRCm39) T1194P probably benign Het
Col6a3 T A 1: 90,743,724 (GRCm39) M208L probably benign Het
Coro7 A T 16: 4,446,538 (GRCm39) probably null Het
Csrnp2 T C 15: 100,379,839 (GRCm39) K484R probably benign Het
Cyp2c39 T A 19: 39,501,639 (GRCm39) V64E probably damaging Het
Ddr2 T C 1: 169,825,701 (GRCm39) K300E probably benign Het
Ddx56 T C 11: 6,213,980 (GRCm39) E393G probably damaging Het
Diaph1 A C 18: 37,986,732 (GRCm39) Y1084* probably null Het
Disp1 A T 1: 182,868,042 (GRCm39) F1459L probably benign Het
Dnajc8 G A 4: 132,271,424 (GRCm39) A80T probably damaging Het
Elfn1 T A 5: 139,957,440 (GRCm39) M148K probably benign Het
Emcn T A 3: 137,124,763 (GRCm39) I154N probably damaging Het
Enah T A 1: 181,733,464 (GRCm39) probably null Het
Enah C G 1: 181,733,463 (GRCm39) probably null Het
Ep300 C A 15: 81,534,182 (GRCm39) Q2080K probably benign Het
Epha2 T A 4: 141,036,068 (GRCm39) M168K probably benign Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fat4 G T 3: 39,050,353 (GRCm39) probably null Het
G3bp1 A G 11: 55,388,786 (GRCm39) R333G possibly damaging Het
Gm3604 A G 13: 62,517,204 (GRCm39) F385L probably benign Het
Gm5800 T C 14: 51,951,157 (GRCm39) I147M possibly damaging Het
Hipk1 A G 3: 103,685,561 (GRCm39) F18S unknown Het
Ighv3-8 A T 12: 114,285,950 (GRCm39) C131S probably benign Het
Il23r T G 6: 67,400,477 (GRCm39) T618P probably damaging Het
Il31ra G A 13: 112,664,063 (GRCm39) T538I possibly damaging Het
Kcns2 A G 15: 34,840,059 (GRCm39) D474G unknown Het
Klc4 T C 17: 46,947,155 (GRCm39) T407A possibly damaging Het
Klra5 C T 6: 129,888,420 (GRCm39) S2N probably benign Het
Krt10 T C 11: 99,279,677 (GRCm39) Y161C probably damaging Het
Kxd1 A T 8: 70,975,928 (GRCm39) M1K probably null Het
Lgals1 A C 15: 78,812,240 (GRCm39) D27A possibly damaging Het
Lgr5 T C 10: 115,302,251 (GRCm39) S308G probably benign Het
Lrp1 G A 10: 127,392,857 (GRCm39) S2736L probably benign Het
Lrpap1 G T 5: 35,259,880 (GRCm39) H73N probably benign Het
Mcpt1 C A 14: 56,256,522 (GRCm39) T86K probably damaging Het
Megf6 A T 4: 154,339,044 (GRCm39) D527V probably damaging Het
Mical3 A T 6: 120,936,351 (GRCm39) S1392T probably benign Het
Mmp2 A T 8: 93,566,010 (GRCm39) D437V probably damaging Het
Mob4 T A 1: 55,191,881 (GRCm39) Y166* probably null Het
Mrap2 G A 9: 87,064,527 (GRCm39) M89I possibly damaging Het
Mug1 G A 6: 121,858,746 (GRCm39) A1155T probably damaging Het
Myh2 G T 11: 67,084,044 (GRCm39) A1556S probably benign Het
Nfatc3 A G 8: 106,845,954 (GRCm39) D1028G probably benign Het
Ngef T G 1: 87,430,985 (GRCm39) probably null Het
Nlrp1a A T 11: 70,983,339 (GRCm39) L1209Q probably null Het
Npr2 C T 4: 43,647,553 (GRCm39) R819C probably damaging Het
Nsd2 A T 5: 34,036,454 (GRCm39) D646V probably damaging Het
Nsun7 A G 5: 66,434,415 (GRCm39) H252R probably damaging Het
Or2a25 T A 6: 42,888,791 (GRCm39) C111* probably null Het
Or2k2 A T 4: 58,785,647 (GRCm39) I25N possibly damaging Het
Or51a10 C T 7: 103,698,947 (GRCm39) V205I probably benign Het
Or8g32 A T 9: 39,305,156 (GRCm39) Q20L probably benign Het
Or8g32 G T 9: 39,305,157 (GRCm39) Q20H probably benign Het
Pcdhga2 A T 18: 37,803,638 (GRCm39) D494V probably damaging Het
Pcsk2 A G 2: 143,655,667 (GRCm39) E617G probably damaging Het
Pdc T C 1: 150,208,931 (GRCm39) I138T probably damaging Het
Phc2 T A 4: 128,641,927 (GRCm39) S750T probably damaging Het
Pkd2l1 T A 19: 44,179,947 (GRCm39) N88Y possibly damaging Het
Plcl1 C T 1: 55,445,757 (GRCm39) R71* probably null Het
Prag1 C A 8: 36,571,048 (GRCm39) L544M probably damaging Het
Prkg2 A G 5: 99,114,369 (GRCm39) probably null Het
Psd2 G A 18: 36,112,764 (GRCm39) S153N probably damaging Het
Rab11fip1 A T 8: 27,643,000 (GRCm39) S600T probably damaging Het
Rbms1 T G 2: 60,592,648 (GRCm39) T222P probably benign Het
Slfn8 A T 11: 82,904,243 (GRCm39) Y382* probably null Het
Socs4 T A 14: 47,527,195 (GRCm39) C43* probably null Het
Sorl1 T A 9: 41,944,922 (GRCm39) T868S probably damaging Het
St6gal1 A G 16: 23,174,963 (GRCm39) Y267C probably damaging Het
Syne1 A G 10: 5,076,682 (GRCm39) V6879A probably benign Het
Syne2 C A 12: 75,900,906 (GRCm39) H22N possibly damaging Het
Tmeff2 T A 1: 50,967,180 (GRCm39) L25Q probably damaging Het
Tmprss11g G T 5: 86,635,285 (GRCm39) D396E probably benign Het
Tmprss11g T A 5: 86,635,295 (GRCm39) H393L probably benign Het
Vmn2r23 A G 6: 123,681,512 (GRCm39) E140G probably damaging Het
Wapl T C 14: 34,399,320 (GRCm39) S130P probably benign Het
Zeb2 T A 2: 44,884,541 (GRCm39) K982M probably damaging Het
Zfhx3 C G 8: 109,683,453 (GRCm39) H3631D unknown Het
Zfp719 T C 7: 43,240,130 (GRCm39) S573P probably damaging Het
Zfp979 A T 4: 147,697,999 (GRCm39) C237S possibly damaging Het
Other mutations in Ercc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ercc6 APN 14 32,290,029 (GRCm39) missense probably damaging 1.00
IGL00796:Ercc6 APN 14 32,291,959 (GRCm39) missense probably benign 0.01
IGL00916:Ercc6 APN 14 32,284,612 (GRCm39) intron probably benign
IGL01743:Ercc6 APN 14 32,274,561 (GRCm39) missense probably damaging 1.00
IGL01802:Ercc6 APN 14 32,284,531 (GRCm39) missense probably damaging 0.99
IGL01886:Ercc6 APN 14 32,291,537 (GRCm39) missense possibly damaging 0.90
IGL02100:Ercc6 APN 14 32,239,052 (GRCm39) missense probably benign 0.00
IGL02115:Ercc6 APN 14 32,298,950 (GRCm39) missense probably damaging 1.00
IGL02755:Ercc6 APN 14 32,297,705 (GRCm39) splice site probably benign
IGL02964:Ercc6 APN 14 32,292,060 (GRCm39) missense probably benign 0.00
IGL02998:Ercc6 APN 14 32,279,814 (GRCm39) missense probably benign 0.05
IGL03150:Ercc6 APN 14 32,280,531 (GRCm39) missense probably damaging 0.96
R0152:Ercc6 UTSW 14 32,268,862 (GRCm39) critical splice donor site probably benign
R0519:Ercc6 UTSW 14 32,248,799 (GRCm39) missense probably damaging 1.00
R0591:Ercc6 UTSW 14 32,279,973 (GRCm39) splice site probably benign
R0894:Ercc6 UTSW 14 32,238,985 (GRCm39) missense probably benign 0.05
R0946:Ercc6 UTSW 14 32,274,578 (GRCm39) missense probably benign 0.08
R1313:Ercc6 UTSW 14 32,274,677 (GRCm39) splice site probably benign
R1506:Ercc6 UTSW 14 32,291,821 (GRCm39) missense probably benign 0.01
R1528:Ercc6 UTSW 14 32,240,979 (GRCm39) missense probably damaging 0.98
R1711:Ercc6 UTSW 14 32,248,133 (GRCm39) missense probably damaging 1.00
R1753:Ercc6 UTSW 14 32,298,956 (GRCm39) missense probably benign
R1795:Ercc6 UTSW 14 32,238,985 (GRCm39) missense probably benign 0.05
R1843:Ercc6 UTSW 14 32,268,777 (GRCm39) missense probably damaging 0.99
R1853:Ercc6 UTSW 14 32,298,773 (GRCm39) missense possibly damaging 0.86
R1859:Ercc6 UTSW 14 32,248,735 (GRCm39) missense probably damaging 1.00
R1912:Ercc6 UTSW 14 32,298,760 (GRCm39) missense probably damaging 1.00
R2308:Ercc6 UTSW 14 32,288,366 (GRCm39) missense possibly damaging 0.70
R2322:Ercc6 UTSW 14 32,248,274 (GRCm39) missense probably damaging 1.00
R2386:Ercc6 UTSW 14 32,263,316 (GRCm39) splice site probably null
R4170:Ercc6 UTSW 14 32,288,754 (GRCm39) missense probably damaging 1.00
R4369:Ercc6 UTSW 14 32,239,164 (GRCm39) missense probably damaging 0.96
R4389:Ercc6 UTSW 14 32,296,865 (GRCm39) nonsense probably null
R4747:Ercc6 UTSW 14 32,291,864 (GRCm39) missense probably benign 0.00
R4811:Ercc6 UTSW 14 32,296,886 (GRCm39) missense probably benign 0.20
R4840:Ercc6 UTSW 14 32,263,253 (GRCm39) missense probably damaging 1.00
R4973:Ercc6 UTSW 14 32,296,859 (GRCm39) missense probably damaging 1.00
R5068:Ercc6 UTSW 14 32,292,020 (GRCm39) missense probably benign 0.01
R5069:Ercc6 UTSW 14 32,292,020 (GRCm39) missense probably benign 0.01
R5070:Ercc6 UTSW 14 32,292,020 (GRCm39) missense probably benign 0.01
R5093:Ercc6 UTSW 14 32,289,479 (GRCm39) missense probably damaging 1.00
R5265:Ercc6 UTSW 14 32,291,580 (GRCm39) missense probably benign 0.01
R5272:Ercc6 UTSW 14 32,240,985 (GRCm39) nonsense probably null
R5499:Ercc6 UTSW 14 32,238,916 (GRCm39) start codon destroyed probably null 0.98
R5795:Ercc6 UTSW 14 32,248,309 (GRCm39) missense probably damaging 0.98
R6258:Ercc6 UTSW 14 32,279,813 (GRCm39) missense probably benign 0.00
R6260:Ercc6 UTSW 14 32,279,813 (GRCm39) missense probably benign 0.00
R6267:Ercc6 UTSW 14 32,248,360 (GRCm39) nonsense probably null
R6291:Ercc6 UTSW 14 32,291,943 (GRCm39) missense probably benign 0.01
R6296:Ercc6 UTSW 14 32,248,360 (GRCm39) nonsense probably null
R6361:Ercc6 UTSW 14 32,239,067 (GRCm39) missense probably benign 0.00
R6500:Ercc6 UTSW 14 32,248,780 (GRCm39) missense probably damaging 0.96
R6555:Ercc6 UTSW 14 32,239,064 (GRCm39) missense probably benign 0.15
R6724:Ercc6 UTSW 14 32,288,288 (GRCm39) missense probably benign 0.01
R7143:Ercc6 UTSW 14 32,292,262 (GRCm39) missense probably damaging 1.00
R7327:Ercc6 UTSW 14 32,248,361 (GRCm39) missense probably benign 0.19
R7396:Ercc6 UTSW 14 32,291,762 (GRCm39) missense probably benign 0.00
R7529:Ercc6 UTSW 14 32,282,686 (GRCm39) nonsense probably null
R7609:Ercc6 UTSW 14 32,288,318 (GRCm39) missense probably benign 0.11
R7802:Ercc6 UTSW 14 32,239,260 (GRCm39) missense probably damaging 1.00
R7854:Ercc6 UTSW 14 32,288,249 (GRCm39) missense probably damaging 1.00
R7995:Ercc6 UTSW 14 32,284,526 (GRCm39) missense probably damaging 0.99
R8181:Ercc6 UTSW 14 32,279,905 (GRCm39) missense probably damaging 1.00
R8320:Ercc6 UTSW 14 32,242,972 (GRCm39) missense probably benign 0.01
R8388:Ercc6 UTSW 14 32,292,297 (GRCm39) utr 3 prime probably benign
R8479:Ercc6 UTSW 14 32,248,363 (GRCm39) missense probably benign 0.00
R8831:Ercc6 UTSW 14 32,282,784 (GRCm39) critical splice donor site probably null
R8849:Ercc6 UTSW 14 32,291,565 (GRCm39) missense probably damaging 1.00
R8912:Ercc6 UTSW 14 32,248,211 (GRCm39) missense probably benign 0.40
R9210:Ercc6 UTSW 14 32,291,822 (GRCm39) missense probably benign 0.00
R9309:Ercc6 UTSW 14 32,240,904 (GRCm39) missense probably damaging 1.00
R9499:Ercc6 UTSW 14 32,284,525 (GRCm39) missense probably damaging 1.00
R9552:Ercc6 UTSW 14 32,284,525 (GRCm39) missense probably damaging 1.00
R9562:Ercc6 UTSW 14 32,296,924 (GRCm39) missense probably damaging 1.00
R9688:Ercc6 UTSW 14 32,297,755 (GRCm39) missense probably benign
R9699:Ercc6 UTSW 14 32,282,703 (GRCm39) missense probably damaging 1.00
R9743:Ercc6 UTSW 14 32,298,943 (GRCm39) missense probably benign 0.01
Z1176:Ercc6 UTSW 14 32,248,444 (GRCm39) missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGAAGACTGCCTGTGAGCAG -3'
(R):5'- ACTCCACAGATAGCAGGTGG -3'

Sequencing Primer
(F):5'- TGGAGAAAGGAAAACTCTCTTTAGC -3'
(R):5'- TGGGTGAACAACGTGGGC -3'
Posted On 2018-11-28