Incidental Mutation 'R0792:Fmo6'
ID82440
Institutional Source Beutler Lab
Gene Symbol Fmo6
Ensembl Gene ENSMUSG00000095576
Gene Nameflavin containing monooxygenase 6
Synonyms
MMRRC Submission 038972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0792 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162916551-162937515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 162920563 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 311 (A311T)
Ref Sequence ENSEMBL: ENSMUSP00000136378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178465] [ENSMUST00000195576]
Predicted Effect probably damaging
Transcript: ENSMUST00000178465
AA Change: A311T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136378
Gene: ENSMUSG00000095576
AA Change: A311T

DomainStartEndE-ValueType
Pfam:FMO-like 2 532 3.2e-273 PFAM
Pfam:Pyr_redox_2 3 226 2e-13 PFAM
Pfam:Pyr_redox_3 6 220 4.6e-17 PFAM
Pfam:K_oxygenase 79 223 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195576
SMART Domains Protein: ENSMUSP00000144106
Gene: ENSMUSG00000095576

DomainStartEndE-ValueType
Pfam:FMO-like 2 118 5.1e-58 PFAM
Pfam:NAD_binding_8 7 84 2.2e-5 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,933,868 probably null Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ahnak G T 19: 9,016,734 M5127I probably benign Het
Akr1c13 T C 13: 4,194,112 Y55H probably damaging Het
Ap3d1 A T 10: 80,708,479 H1161Q probably benign Het
Atp2b2 C T 6: 113,773,388 R625H probably damaging Het
Bdnf G A 2: 109,724,118 C239Y probably damaging Het
Bpifa5 G T 2: 154,165,619 probably null Het
C9 T A 15: 6,486,762 F349I probably damaging Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Cep68 A T 11: 20,240,652 L120H possibly damaging Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Cpne1 G T 2: 156,077,419 Q343K probably benign Het
D3Ertd254e A G 3: 36,164,562 M244V probably benign Het
Dlc1 A T 8: 36,938,548 I29K probably benign Het
Dnah9 T C 11: 65,896,001 D3602G possibly damaging Het
Dock1 A G 7: 134,874,150 S885G probably benign Het
Evpl T A 11: 116,227,723 Q686L probably damaging Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Grin2c G A 11: 115,250,646 P882L probably damaging Het
H2-Ob C T 17: 34,242,614 T109I probably damaging Het
Jpt2 C A 17: 24,948,673 A101S probably benign Het
Krt2 A G 15: 101,816,497 V226A probably damaging Het
Lamc1 C A 1: 153,234,580 Q1116H possibly damaging Het
Lamc1 T G 1: 153,234,595 Q1111H probably damaging Het
Lamc1 T C 1: 153,234,612 S1106G probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Ltbp4 G T 7: 27,325,060 P715Q probably damaging Het
Mtor T C 4: 148,462,910 V450A probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myom1 A T 17: 71,121,136 I1450F probably damaging Het
Naip6 A G 13: 100,283,766 I1332T possibly damaging Het
Ncstn A G 1: 172,071,505 V353A possibly damaging Het
Nt5c3 T C 6: 56,886,749 T149A probably benign Het
Olfr203 A T 16: 59,303,989 I280F probably damaging Het
Olfr510 A G 7: 108,668,157 H247R probably damaging Het
Paip1 T C 13: 119,430,318 S54P possibly damaging Het
Prdm14 G T 1: 13,125,744 A31E probably benign Het
Prr14l A G 5: 32,828,423 S1243P probably damaging Het
Prss1 T C 6: 41,458,944 M1T probably null Het
Raver2 T A 4: 101,102,950 V209D probably damaging Het
Scube1 T A 15: 83,628,076 probably null Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Slc16a13 A T 11: 70,220,631 V16E probably damaging Het
Slc30a6 T C 17: 74,415,645 S236P possibly damaging Het
Sobp A C 10: 43,022,693 S299A probably damaging Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Trak2 A T 1: 58,903,661 M862K probably benign Het
Ubox5 A T 2: 130,600,710 V19E probably damaging Het
Vmn1r173 A G 7: 23,702,735 T132A probably benign Het
Zfp820 T C 17: 21,819,528 D273G probably benign Het
Other mutations in Fmo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Fmo6 APN 1 162930011 nonsense probably null
IGL02083:Fmo6 APN 1 162920464 nonsense probably null
adventure UTSW 1 162922810 missense probably benign
R0940:Fmo6 UTSW 1 162926226 missense probably benign 0.07
R1173:Fmo6 UTSW 1 162926141 missense probably damaging 1.00
R1268:Fmo6 UTSW 1 162920517 missense probably damaging 1.00
R1538:Fmo6 UTSW 1 162926106 missense probably damaging 1.00
R1694:Fmo6 UTSW 1 162922672 missense probably benign
R1717:Fmo6 UTSW 1 162926252 nonsense probably null
R1837:Fmo6 UTSW 1 162922810 missense probably benign
R2125:Fmo6 UTSW 1 162929958 missense possibly damaging 0.82
R2434:Fmo6 UTSW 1 162916870 missense probably benign 0.00
R2894:Fmo6 UTSW 1 162922724 nonsense probably null
R4864:Fmo6 UTSW 1 162924395 missense probably benign 0.34
R6414:Fmo6 UTSW 1 162920445 missense probably damaging 0.97
R6576:Fmo6 UTSW 1 162922695 missense probably damaging 1.00
R6883:Fmo6 UTSW 1 162929892 missense probably damaging 1.00
R7013:Fmo6 UTSW 1 162918248 missense probably benign 0.00
R7014:Fmo6 UTSW 1 162926308 missense probably benign 0.13
R7657:Fmo6 UTSW 1 162922716 missense probably benign
X0025:Fmo6 UTSW 1 162920496 missense probably benign 0.29
X0025:Fmo6 UTSW 1 162922858 missense probably damaging 1.00
Z1176:Fmo6 UTSW 1 162926132 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCTAGTTGAGGAGGGAAGATGCC -3'
(R):5'- TCTACTTGGTGAGTCTCCGAAGACC -3'

Sequencing Primer
(F):5'- ATAGCCTGTGGCGAAGATGA -3'
(R):5'- GAATTTCTGCCTGAGAAGCAC -3'
Posted On2013-11-08