Mutagenetix > Incidental Mutation

Incidental Mutation 'R7307:Krt82'

567346

Institutional Source

Beutler Lab

Gene Symbol

Krt82

Ensembl Gene

ENSMUSG00000049548

Gene Name

keratin 82

Synonyms

Krt2-20

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R7307 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101541214-101550667 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101542907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 356 (C356R)

Ref Sequence

ENSEMBL: ENSMUSP00000023713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023713]

AlphaFold

Q99M74

Predicted Effect

probably damaging
Transcript: ENSMUST00000023713
AA Change: C356R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023713
Gene: ENSMUSG00000049548
AA Change: C356R

Domain	Start	End	E-Value	Type
low complexity region	38	57	N/A	INTRINSIC
Pfam:Keratin_2_head	61	114	6.1e-13	PFAM
Filament	117	428	1.32e-153	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this keratin appears to be a hair cuticle-specific keratin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	G	A	16: 17,118,395	P155L	probably benign	Het
Adamts12	G	T	15: 11,217,813	L285F	probably damaging	Het
Ankrd6	A	T	4: 32,816,949	Y393N	possibly damaging	Het
Arhgap45	A	G	10: 80,029,182	Q993R	probably benign	Het
Arhgef33	G	C	17: 80,347,120		probably null	Het
B4galnt3	T	C	6: 120,215,431	D448G	probably benign	Het
Capn1	C	G	19: 5,993,908	E564D	possibly damaging	Het
Ccdc85a	A	G	11: 28,399,384	S474P	probably benign	Het
Cdk12	T	A	11: 98,249,800	L1289*	probably null	Het
Cramp1l	A	T	17: 24,974,745	N920K	possibly damaging	Het
Cubn	C	T	2: 13,340,332	S2091N	probably damaging	Het
Ddx1	A	T	12: 13,223,959	I581N	probably damaging	Het
Dnm2	A	T	9: 21,485,687	N487Y	probably damaging	Het
Enc1	A	C	13: 97,245,093	N37T	probably damaging	Het
Ephb3	T	G	16: 21,222,226	I932S	probably benign	Het
Frk	T	A	10: 34,591,938	M316K	probably damaging	Het
Gdap2	C	T	3: 100,202,033	R25C	unknown	Het
Gm10436	A	C	12: 88,181,749	C32W	probably damaging	Het
Gpat2	T	A	2: 127,434,890	D671E	probably damaging	Het
Gpr179	C	T	11: 97,338,846	E828K	probably benign	Het
Greb1l	T	C	18: 10,538,142	Y1052H	probably damaging	Het
Gtf2f1	C	T	17: 57,007,833	S69N	probably damaging	Het
Hid1	A	C	11: 115,348,482	I785S	probably damaging	Het
Hmcn2	T	C	2: 31,343,081	I214T	probably damaging	Het
Hsd3b5	G	T	3: 98,619,769	F120L	probably damaging	Het
Kif16b	C	T	2: 142,712,931	R649Q	probably benign	Het
Kif17	A	T	4: 138,262,643	E47D	probably benign	Het
Kmt2b	T	C	7: 30,580,471	H1368R	probably damaging	Het
Kmt2d	A	T	15: 98,849,418	S3342T	unknown	Het
Lrit2	A	G	14: 37,072,199	K407E	probably benign	Het
Malt1	T	A	18: 65,451,569	H325Q	possibly damaging	Het
Mccc2	T	G	13: 99,988,600	D187A	possibly damaging	Het
Mgll	T	A	6: 88,814,121		probably null	Het
Mindy2	T	G	9: 70,610,959	E449A	possibly damaging	Het
Muc5b	G	A	7: 141,842,294	V96M	unknown	Het
Nlrp4e	A	G	7: 23,321,528	E480G	probably benign	Het
Nup98	A	G	7: 102,134,795	I1093T	probably benign	Het
Olfr1288	A	T	2: 111,478,760		probably benign	Het
Olfr243	G	T	7: 103,716,966	R124L	probably damaging	Het
Olfr350	G	A	2: 36,850,125	M26I	probably benign	Het
Olfr541	G	A	7: 140,705,147	V299I	probably benign	Het
Pcdhb6	A	T	18: 37,335,478	H484L	probably benign	Het
Phldb1	T	C	9: 44,694,047	T604A	possibly damaging	Het
Pitpnm3	G	T	11: 72,070,964	A275D	probably damaging	Het
Polr2a	A	T	11: 69,747,292		probably null	Het
Polr3a	A	G	14: 24,459,987	C960R	probably benign	Het
Pou6f2	G	A	13: 18,239,713	A159V		Het
Pramef6	A	C	4: 143,896,775	Y276*	probably null	Het
Psmc4	A	G	7: 28,042,660	V303A	probably benign	Het
Ptdss2	A	G	7: 141,151,732	N151S	possibly damaging	Het
Ptprk	T	A	10: 28,589,008	Y1295*	probably null	Het
Rbm19	A	G	5: 120,186,218	K881E	possibly damaging	Het
Rcan2	T	A	17: 44,021,102	Y183*	probably null	Het
Rnd1	T	C	15: 98,670,799	E166G	probably damaging	Het
Rnf113a2	T	A	12: 84,418,179	C282S	probably damaging	Het
S100b	G	A	10: 76,257,092	G20R	probably benign	Het
Sae1	G	T	7: 16,368,544	Y168*	probably null	Het
Samd9l	C	A	6: 3,372,600	G1554*	probably null	Het
Samhd1	T	C	2: 157,135,020	S55G	probably benign	Het
Sgsm1	T	C	5: 113,273,646	D525G	probably benign	Het
Slc28a3	A	T	13: 58,563,172	M512K	probably damaging	Het
Slc9b2	T	A	3: 135,318,390	N67K	probably benign	Het
Smarca4	T	A	9: 21,638,800	I402N	probably damaging	Het
St7l	T	C	3: 104,889,353	F261L	probably benign	Het
Syde2	T	A	3: 146,015,798	V1140D	probably damaging	Het
Syt6	T	A	3: 103,587,472	I251N	probably damaging	Het
Taok2	T	C	7: 126,866,818	E916G	probably damaging	Het
Tecta	A	G	9: 42,377,992	S426P	probably damaging	Het
Thra	T	C	11: 98,764,308	I338T	probably damaging	Het
Trub1	A	T	19: 57,472,703	Y137F	probably damaging	Het
Vps13b	T	C	15: 35,841,545	F2574L	probably benign	Het
Ythdf3	T	C	3: 16,183,500	S2P	possibly damaging	Het
Zc3h13	T	A	14: 75,330,541	D1091E	probably damaging	Het
Zdhhc6	A	G	19: 55,313,250	Y100H	probably damaging	Het

Other mutations in Krt82

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Krt82	APN	15	101543378	missense	probably damaging	0.97
IGL01112:Krt82	APN	15	101545523	missense	probably damaging	1.00
IGL01820:Krt82	APN	15	101543452	splice site	probably benign
IGL02529:Krt82	APN	15	101550396	nonsense	probably null
IGL02894:Krt82	APN	15	101542720	missense	probably damaging	1.00
IGL02974:Krt82	APN	15	101550585	nonsense	probably null
IGL03263:Krt82	APN	15	101541872	missense	probably benign	0.00
R0268:Krt82	UTSW	15	101541713	missense	probably benign	0.02
R0385:Krt82	UTSW	15	101545593	missense	probably damaging	1.00
R0542:Krt82	UTSW	15	101545600	splice site	probably benign
R1073:Krt82	UTSW	15	101550254	missense	probably damaging	1.00
R1601:Krt82	UTSW	15	101545153	missense	probably damaging	1.00
R1795:Krt82	UTSW	15	101543384	missense	possibly damaging	0.90
R1944:Krt82	UTSW	15	101548535	missense	probably damaging	1.00
R1974:Krt82	UTSW	15	101545162	missense	probably benign	0.00
R2049:Krt82	UTSW	15	101545156	missense	probably damaging	0.96
R2140:Krt82	UTSW	15	101545156	missense	probably damaging	0.96
R2851:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R2852:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R2853:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R3815:Krt82	UTSW	15	101550600	missense	probably damaging	1.00
R4324:Krt82	UTSW	15	101541747	missense	probably benign	0.00
R4798:Krt82	UTSW	15	101550488	missense	probably benign	0.01
R4980:Krt82	UTSW	15	101545099	missense	possibly damaging	0.85
R5212:Krt82	UTSW	15	101545049	missense	probably damaging	1.00
R5260:Krt82	UTSW	15	101548388	missense	possibly damaging	0.88
R5821:Krt82	UTSW	15	101548385	nonsense	probably null
R6009:Krt82	UTSW	15	101545105	missense	probably benign	0.00
R6955:Krt82	UTSW	15	101542849	missense	probably damaging	1.00
R7194:Krt82	UTSW	15	101542756	missense	probably damaging	1.00
R7420:Krt82	UTSW	15	101545587	missense	probably damaging	0.96
R7837:Krt82	UTSW	15	101548357	missense	possibly damaging	0.86
R8354:Krt82	UTSW	15	101541803	missense	probably damaging	1.00
R8371:Krt82	UTSW	15	101545111	missense	probably benign	0.12
R8454:Krt82	UTSW	15	101541803	missense	probably damaging	1.00
R8692:Krt82	UTSW	15	101548393	missense	possibly damaging	0.75
R9111:Krt82	UTSW	15	101543351	missense	probably benign	0.01
R9187:Krt82	UTSW	15	101541825	missense	probably benign	0.01
R9346:Krt82	UTSW	15	101550524	missense	probably benign
R9527:Krt82	UTSW	15	101546123	missense	probably benign	0.39
Z1176:Krt82	UTSW	15	101541852	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAGGTGGCGATCTCGATGTC -3'
(R):5'- TGCTGTCAGAGAAGTAGCCAG -3'

Sequencing Primer
(F):5'- ATCTCGATGTCCAGCCCCAG -3'
(R):5'- GGCAGAAGACTAAACTCAGGCTCTC -3'

Posted On

2019-06-26