Mutagenetix > Incidental Mutation

Incidental Mutation 'R1016:Cntnap1'

96344

Institutional Source

Beutler Lab

Gene Symbol

Cntnap1

Ensembl Gene

ENSMUSG00000017167

Gene Name

contactin associated protein-like 1

Synonyms

Nrxn4, NCP1, Caspr, paranodin, p190, shm

MMRRC Submission

039120-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.496) question?

Stock #

R1016 (G1)

Quality Score

214

Status

Not validated

Chromosome

Chromosomal Location

101065429-101081550 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101068333 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 86 (V86A)

Ref Sequence

ENSEMBL: ENSMUSP00000099398 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062759] [ENSMUST00000103109]

AlphaFold

O54991

Predicted Effect

probably benign
Transcript: ENSMUST00000062759

SMART Domains

Protein: ENSMUSP00000062588
Gene: ENSMUSG00000044052

Domain	Start	End	E-Value	Type
Pfam:7tm_1	58	310	4.8e-43	PFAM
low complexity region	313	329	N/A	INTRINSIC
low complexity region	336	349	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000103109
AA Change: V86A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167
AA Change: V86A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
FA58C	25	169	7.49e-36	SMART
LamG	196	333	2.86e-32	SMART
LamG	382	516	3.49e-27	SMART
EGF	544	578	2.28e0	SMART
Blast:FBG	580	777	1e-133	BLAST
LamG	806	940	1.95e-25	SMART
EGF_like	961	997	6.03e1	SMART
low complexity region	1032	1044	N/A	INTRINSIC
low complexity region	1047	1058	N/A	INTRINSIC
low complexity region	1063	1078	N/A	INTRINSIC
LamG	1081	1219	2.59e-30	SMART
4.1m	1305	1323	7.85e-7	SMART
low complexity region	1333	1370	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138942

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.6%
20x: 84.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ceacam20	T	A	7: 19,710,227 (GRCm39)	H6Q	probably null	Het
Clstn1	T	C	4: 149,731,286 (GRCm39)	I866T	probably benign	Het
Crtc1	A	T	8: 70,844,769 (GRCm39)	Y351*	probably null	Het
Cul7	T	A	17: 46,974,116 (GRCm39)	L1467H	probably damaging	Het
Cyp2j12	C	T	4: 96,001,102 (GRCm39)		probably null	Het
Dmrt2	A	T	19: 25,652,938 (GRCm39)	K183N	probably damaging	Het
Fancl	G	T	11: 26,337,195 (GRCm39)		probably benign	Het
Fbxo40	G	A	16: 36,789,539 (GRCm39)	Q524*	probably null	Het
Flcn	T	C	11: 59,686,691 (GRCm39)		probably null	Het
Gm19965	T	A	1: 116,749,031 (GRCm39)	C237*	probably null	Het
Hpf1	A	G	8: 61,348,678 (GRCm39)	Y131C	possibly damaging	Het
Mdh1	A	G	11: 21,509,769 (GRCm39)	L202P	probably benign	Het
Mpl	T	C	4: 118,306,110 (GRCm39)	Y310C	probably damaging	Het
Mtus1	A	G	8: 41,503,063 (GRCm39)	V784A	probably benign	Het
Myg1	T	C	15: 102,242,786 (GRCm39)	I159T	possibly damaging	Het
Nans	T	C	4: 46,500,716 (GRCm39)	Y203H	probably benign	Het
Ncapg2	G	A	12: 116,402,295 (GRCm39)	C709Y	probably damaging	Het
Or8b36	T	C	9: 37,937,987 (GRCm39)	V295A	probably damaging	Het
Parp12	T	C	6: 39,088,660 (GRCm39)	Y192C	probably damaging	Het
Plekha6	A	G	1: 133,187,832 (GRCm39)	N118D	probably benign	Het
Prg4	T	C	1: 150,330,442 (GRCm39)		probably benign	Het
Psip1	T	C	4: 83,378,135 (GRCm39)	T454A	possibly damaging	Het
Ptprz1	T	C	6: 23,000,973 (GRCm39)	L1021P	probably damaging	Het
Pvr	T	C	7: 19,643,142 (GRCm39)	I364V	probably benign	Het
Serpina5	A	G	12: 104,071,582 (GRCm39)	I396M	probably damaging	Het
Sgcb	A	C	5: 73,797,183 (GRCm39)	H192Q	probably benign	Het
Slc4a9	C	A	18: 36,664,478 (GRCm39)	H379N	probably benign	Het
Tet1	T	C	10: 62,715,729 (GRCm39)	D22G	probably benign	Het
Trim34a	T	C	7: 103,897,167 (GRCm39)	V77A	probably benign	Het
Ttc7b	T	C	12: 100,369,617 (GRCm39)	E384G	probably null	Het
Vmn2r16	G	A	5: 109,487,754 (GRCm39)	G209D	probably damaging	Het

Other mutations in Cntnap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Cntnap1	APN	11	101,075,918 (GRCm39)	missense	possibly damaging	0.63
IGL00715:Cntnap1	APN	11	101,074,031 (GRCm39)	splice site	probably benign
IGL00792:Cntnap1	APN	11	101,069,792 (GRCm39)	missense	probably benign	0.19
IGL01063:Cntnap1	APN	11	101,072,614 (GRCm39)	missense	probably benign	0.00
IGL01141:Cntnap1	APN	11	101,069,633 (GRCm39)	splice site	probably benign
IGL02184:Cntnap1	APN	11	101,069,191 (GRCm39)	missense	probably damaging	0.98
IGL02272:Cntnap1	APN	11	101,069,142 (GRCm39)	missense	probably damaging	0.99
IGL02281:Cntnap1	APN	11	101,073,080 (GRCm39)	missense	possibly damaging	0.86
IGL02437:Cntnap1	APN	11	101,077,677 (GRCm39)	missense	probably damaging	1.00
IGL02456:Cntnap1	APN	11	101,068,955 (GRCm39)	missense	probably benign	0.31
IGL02966:Cntnap1	APN	11	101,075,575 (GRCm39)	missense	probably damaging	1.00
IGL03126:Cntnap1	APN	11	101,067,127 (GRCm39)	missense	probably benign	0.00
IGL03294:Cntnap1	APN	11	101,072,508 (GRCm39)	missense	possibly damaging	0.94
Penny	UTSW	11	101,077,590 (GRCm39)	missense	probably damaging	0.99
FR4304:Cntnap1	UTSW	11	101,080,415 (GRCm39)	unclassified	probably benign
FR4304:Cntnap1	UTSW	11	101,080,407 (GRCm39)	unclassified	probably benign
FR4342:Cntnap1	UTSW	11	101,080,401 (GRCm39)	unclassified	probably benign
FR4449:Cntnap1	UTSW	11	101,080,419 (GRCm39)	unclassified	probably benign
FR4449:Cntnap1	UTSW	11	101,080,395 (GRCm39)	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101,080,419 (GRCm39)	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101,080,405 (GRCm39)	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101,080,398 (GRCm39)	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101,080,420 (GRCm39)	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101,080,401 (GRCm39)	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101,080,392 (GRCm39)	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101,080,407 (GRCm39)	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101,080,406 (GRCm39)	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101,080,416 (GRCm39)	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101,080,395 (GRCm39)	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101,080,402 (GRCm39)	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101,080,408 (GRCm39)	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101,080,414 (GRCm39)	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101,080,395 (GRCm39)	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101,080,398 (GRCm39)	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101,080,411 (GRCm39)	unclassified	probably benign
PIT4354001:Cntnap1	UTSW	11	101,072,123 (GRCm39)	missense	probably damaging	1.00
PIT4466001:Cntnap1	UTSW	11	101,068,131 (GRCm39)	missense	probably benign
R0329:Cntnap1	UTSW	11	101,079,135 (GRCm39)	missense	probably damaging	1.00
R0556:Cntnap1	UTSW	11	101,074,822 (GRCm39)	missense	probably benign
R0586:Cntnap1	UTSW	11	101,077,840 (GRCm39)	missense	probably damaging	0.97
R0635:Cntnap1	UTSW	11	101,074,285 (GRCm39)	missense	probably benign	0.05
R0789:Cntnap1	UTSW	11	101,072,210 (GRCm39)	splice site	probably benign
R1085:Cntnap1	UTSW	11	101,069,662 (GRCm39)	missense	probably benign	0.02
R1211:Cntnap1	UTSW	11	101,075,536 (GRCm39)	missense	probably damaging	1.00
R1466:Cntnap1	UTSW	11	101,071,186 (GRCm39)	missense	probably damaging	1.00
R1466:Cntnap1	UTSW	11	101,071,186 (GRCm39)	missense	probably damaging	1.00
R1584:Cntnap1	UTSW	11	101,071,186 (GRCm39)	missense	probably damaging	1.00
R1689:Cntnap1	UTSW	11	101,079,699 (GRCm39)	splice site	probably null
R1758:Cntnap1	UTSW	11	101,075,449 (GRCm39)	missense	probably damaging	1.00
R1779:Cntnap1	UTSW	11	101,077,337 (GRCm39)	missense	probably damaging	0.99
R1964:Cntnap1	UTSW	11	101,068,850 (GRCm39)	nonsense	probably null
R1966:Cntnap1	UTSW	11	101,071,212 (GRCm39)	missense	possibly damaging	0.89
R2070:Cntnap1	UTSW	11	101,073,805 (GRCm39)	missense	probably damaging	1.00
R2088:Cntnap1	UTSW	11	101,073,373 (GRCm39)	missense	probably damaging	1.00
R2118:Cntnap1	UTSW	11	101,079,483 (GRCm39)	missense	probably benign
R3795:Cntnap1	UTSW	11	101,077,590 (GRCm39)	missense	probably damaging	0.99
R4375:Cntnap1	UTSW	11	101,073,079 (GRCm39)	missense	probably damaging	1.00
R4779:Cntnap1	UTSW	11	101,068,898 (GRCm39)	missense	possibly damaging	0.91
R4832:Cntnap1	UTSW	11	101,073,845 (GRCm39)	missense	probably damaging	1.00
R4965:Cntnap1	UTSW	11	101,068,251 (GRCm39)	missense	possibly damaging	0.52
R4981:Cntnap1	UTSW	11	101,067,159 (GRCm39)	splice site	probably null
R5008:Cntnap1	UTSW	11	101,079,567 (GRCm39)	nonsense	probably null
R5399:Cntnap1	UTSW	11	101,074,142 (GRCm39)	missense	probably benign
R5507:Cntnap1	UTSW	11	101,074,303 (GRCm39)	missense	probably benign	0.42
R5560:Cntnap1	UTSW	11	101,073,261 (GRCm39)	missense	probably damaging	1.00
R5589:Cntnap1	UTSW	11	101,075,944 (GRCm39)	missense	probably benign
R6038:Cntnap1	UTSW	11	101,075,462 (GRCm39)	missense	probably benign	0.12
R6038:Cntnap1	UTSW	11	101,075,462 (GRCm39)	missense	probably benign	0.12
R6242:Cntnap1	UTSW	11	101,073,364 (GRCm39)	missense	probably damaging	1.00
R6306:Cntnap1	UTSW	11	101,075,441 (GRCm39)	missense	probably damaging	1.00
R6392:Cntnap1	UTSW	11	101,077,472 (GRCm39)	missense	probably damaging	1.00
R6803:Cntnap1	UTSW	11	101,068,060 (GRCm39)	missense	possibly damaging	0.81
R6939:Cntnap1	UTSW	11	101,077,337 (GRCm39)	missense	probably damaging	0.99
R6944:Cntnap1	UTSW	11	101,073,730 (GRCm39)	missense	probably damaging	0.97
R7152:Cntnap1	UTSW	11	101,068,152 (GRCm39)	missense	probably damaging	1.00
R7297:Cntnap1	UTSW	11	101,079,460 (GRCm39)	missense	probably benign	0.01
R7347:Cntnap1	UTSW	11	101,076,094 (GRCm39)	missense	probably damaging	1.00
R7961:Cntnap1	UTSW	11	101,069,121 (GRCm39)	missense	probably benign
R7980:Cntnap1	UTSW	11	101,079,719 (GRCm39)	missense	probably benign
R8307:Cntnap1	UTSW	11	101,079,702 (GRCm39)	missense	possibly damaging	0.73
R8386:Cntnap1	UTSW	11	101,073,029 (GRCm39)	missense	probably damaging	1.00
R8403:Cntnap1	UTSW	11	101,068,416 (GRCm39)	missense	probably damaging	1.00
R8826:Cntnap1	UTSW	11	101,077,655 (GRCm39)	missense	probably damaging	0.99
R9103:Cntnap1	UTSW	11	101,072,094 (GRCm39)	missense	probably benign	0.06
R9279:Cntnap1	UTSW	11	101,072,121 (GRCm39)	missense	probably damaging	0.99
R9284:Cntnap1	UTSW	11	101,068,137 (GRCm39)	missense	probably benign
R9386:Cntnap1	UTSW	11	101,076,052 (GRCm39)	missense	probably damaging	1.00
R9689:Cntnap1	UTSW	11	101,072,178 (GRCm39)	missense	probably damaging	0.98
R9697:Cntnap1	UTSW	11	101,068,828 (GRCm39)	missense	possibly damaging	0.51
RF042:Cntnap1	UTSW	11	101,071,131 (GRCm39)	critical splice acceptor site	probably benign
RF048:Cntnap1	UTSW	11	101,080,389 (GRCm39)	unclassified	probably benign
RF048:Cntnap1	UTSW	11	101,071,131 (GRCm39)	critical splice acceptor site	probably benign
RF049:Cntnap1	UTSW	11	101,080,422 (GRCm39)	unclassified	probably benign
RF049:Cntnap1	UTSW	11	101,080,418 (GRCm39)	unclassified	probably benign
RF050:Cntnap1	UTSW	11	101,080,418 (GRCm39)	unclassified	probably benign
Z1176:Cntnap1	UTSW	11	101,073,724 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATGGACTCTTTACCACAGCCCGC -3'
(R):5'- TCACTGAACTCAGGAAGCTCTCTCC -3'

Sequencing Primer
(F):5'- TTTGCCCGGCTACATGG -3'
(R):5'- GTCCGAGCTGACTAAATTCCAAG -3'

Posted On

2014-01-05