Incidental Mutation 'R1019:Olfr355'
ID96702
Institutional Source Beutler Lab
Gene Symbol Olfr355
Ensembl Gene ENSMUSG00000075380
Gene Nameolfactory receptor 355
SynonymsMOR138-2, GA_x6K02T2NLDC-33622642-33621710
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36925190-36928897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36927752 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 121 (F121L)
Ref Sequence ENSEMBL: ENSMUSP00000151206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100147] [ENSMUST00000213574]
Predicted Effect probably benign
Transcript: ENSMUST00000100147
AA Change: F121L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097725
Gene: ENSMUSG00000075380
AA Change: F121L

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.9e-55 PFAM
Pfam:7tm_1 42 290 2.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213574
AA Change: F121L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Olfr355
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Olfr355 APN 2 36927812 nonsense probably null
IGL02523:Olfr355 APN 2 36927955 missense probably damaging 0.99
BB002:Olfr355 UTSW 2 36927359 missense possibly damaging 0.80
BB012:Olfr355 UTSW 2 36927359 missense possibly damaging 0.80
IGL03050:Olfr355 UTSW 2 36927808 missense probably damaging 0.99
R0458:Olfr355 UTSW 2 36927337 missense probably damaging 1.00
R1115:Olfr355 UTSW 2 36927502 missense possibly damaging 0.72
R1460:Olfr355 UTSW 2 36927808 missense probably damaging 0.99
R1663:Olfr355 UTSW 2 36927334 missense probably damaging 1.00
R1902:Olfr355 UTSW 2 36927185 missense probably benign 0.00
R2964:Olfr355 UTSW 2 36927407 missense probably benign 0.00
R4751:Olfr355 UTSW 2 36927583 missense probably damaging 1.00
R4884:Olfr355 UTSW 2 36928012 missense possibly damaging 0.65
R4935:Olfr355 UTSW 2 36927701 missense probably benign 0.05
R6114:Olfr355 UTSW 2 36927689 missense possibly damaging 0.93
R6184:Olfr355 UTSW 2 36927392 missense probably damaging 1.00
R6476:Olfr355 UTSW 2 36927583 missense possibly damaging 0.75
R7167:Olfr355 UTSW 2 36927521 missense probably benign 0.00
R7323:Olfr355 UTSW 2 36927974 missense probably damaging 1.00
R7539:Olfr355 UTSW 2 36927209 missense probably benign 0.02
R7925:Olfr355 UTSW 2 36927359 missense possibly damaging 0.80
R8284:Olfr355 UTSW 2 36928006 missense probably damaging 0.99
X0025:Olfr355 UTSW 2 36927950 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTCCCAGCAGCAGAAGGGATCTTG -3'
(R):5'- AGGGAACCTGCTCATCATTCTGGC -3'

Sequencing Primer
(F):5'- TTTTAACAGAGGACTGAGGTCAC -3'
(R):5'- GGCCATCCGTTCTGACC -3'
Posted On2014-01-05