Incidental Mutation 'R1019:Slc37a1'
ID96799
Institutional Source Beutler Lab
Gene Symbol Slc37a1
Ensembl Gene ENSMUSG00000024036
Gene Namesolute carrier family 37 (glycerol-3-phosphate transporter), member 1
SynonymsG3PP
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location31295483-31350696 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31315594 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 80 (N80S)
Ref Sequence ENSEMBL: ENSMUSP00000126111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165149] [ENSMUST00000171233]
Predicted Effect probably benign
Transcript: ENSMUST00000165149
AA Change: N80S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128223
Gene: ENSMUSG00000024036
AA Change: N80S

DomainStartEndE-ValueType
Pfam:MFS_1 21 452 6.7e-33 PFAM
transmembrane domain 462 484 N/A INTRINSIC
transmembrane domain 489 511 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171233
AA Change: N80S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126111
Gene: ENSMUSG00000024036
AA Change: N80S

DomainStartEndE-ValueType
Pfam:MFS_1 22 452 3.5e-33 PFAM
transmembrane domain 462 484 N/A INTRINSIC
transmembrane domain 489 511 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the endoplasmic reticulum (ER) membrane. This protein translocates glucose-6-phosphate from the cytoplasm into the lumen of the ER for hydrolysis into glucose by another ER membrane protein. This gene is a member of the solute carrier 37 gene family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Slc37a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01594:Slc37a1 APN 17 31319148 nonsense probably null
IGL01829:Slc37a1 APN 17 31322206 missense possibly damaging 0.72
IGL02429:Slc37a1 APN 17 31300509 critical splice donor site probably null
IGL02716:Slc37a1 APN 17 31328161 missense possibly damaging 0.57
gluttony UTSW 17 31338990 missense possibly damaging 0.95
R1675:Slc37a1 UTSW 17 31338074 missense probably damaging 0.99
R1768:Slc37a1 UTSW 17 31333678 missense possibly damaging 0.53
R1822:Slc37a1 UTSW 17 31300431 start gained probably benign
R3685:Slc37a1 UTSW 17 31325693 missense probably benign 0.36
R4826:Slc37a1 UTSW 17 31322173 missense probably damaging 1.00
R4989:Slc37a1 UTSW 17 31322146 missense probably damaging 0.98
R5326:Slc37a1 UTSW 17 31340262 missense probably damaging 1.00
R5542:Slc37a1 UTSW 17 31340262 missense probably damaging 1.00
R5588:Slc37a1 UTSW 17 31346457 missense probably damaging 1.00
R5609:Slc37a1 UTSW 17 31338008 missense possibly damaging 0.67
R6479:Slc37a1 UTSW 17 31338990 missense possibly damaging 0.95
R7409:Slc37a1 UTSW 17 31340263 missense probably damaging 1.00
R7743:Slc37a1 UTSW 17 31316185 missense probably damaging 1.00
R8140:Slc37a1 UTSW 17 31322259 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAATGCTGCCAGAGCCTCCTGTC -3'
(R):5'- TGTTTGCTAGGGTCCAGTCGTCAC -3'

Sequencing Primer
(F):5'- AACTCCTGTGGATGTCAGAC -3'
(R):5'- GTCGTCACTGAAAGGCACTC -3'
Posted On2014-01-05