Incidental Mutation 'R1019:Kifc1'
ID96801
Institutional Source Beutler Lab
Gene Symbol Kifc1
Ensembl Gene ENSMUSG00000079553
Gene Namekinesin family member C1
Synonymskinesin family c-terminal 5A, Knsl2a, Tctex-7, KNSL2, Kifc5a, Gm4137, Tctex7a, Tctex7, HSET, Tctex-7A
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1019 (G1)
Quality Score124
Status Not validated
Chromosome17
Chromosomal Location33875666-33890661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33884711 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 195 (R195C)
Ref Sequence ENSEMBL: ENSMUSP00000133758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114361] [ENSMUST00000173386] [ENSMUST00000173492]
Predicted Effect probably benign
Transcript: ENSMUST00000114361
SMART Domains Protein: ENSMUSP00000110001
Gene: ENSMUSG00000079553

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
Blast:KISc 82 155 2e-12 BLAST
low complexity region 156 179 N/A INTRINSIC
KISc 246 609 1.77e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172608
Predicted Effect probably benign
Transcript: ENSMUST00000173386
AA Change: R195C

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133758
Gene: ENSMUSG00000079553
AA Change: R195C

DomainStartEndE-ValueType
Blast:KISc 67 204 4e-31 BLAST
low complexity region 206 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173492
AA Change: R213C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134572
Gene: ENSMUSG00000079553
AA Change: R213C

DomainStartEndE-ValueType
low complexity region 108 119 N/A INTRINSIC
low complexity region 224 242 N/A INTRINSIC
KISc 309 672 1.77e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173885
Predicted Effect probably benign
Transcript: ENSMUST00000173982
SMART Domains Protein: ENSMUSP00000133520
Gene: ENSMUSG00000079553

DomainStartEndE-ValueType
Blast:KISc 2 44 8e-22 BLAST
PDB:2REP|A 2 51 6e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185129
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Kifc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02707:Kifc1 APN 17 33881493 nonsense probably null
R0540:Kifc1 UTSW 17 33886647 missense probably damaging 0.98
R0607:Kifc1 UTSW 17 33886647 missense probably damaging 0.98
R1218:Kifc1 UTSW 17 33884711 missense probably benign 0.02
R1219:Kifc1 UTSW 17 33884711 missense probably benign 0.02
R1222:Kifc1 UTSW 17 33884711 missense probably benign 0.02
R1374:Kifc1 UTSW 17 33883875 missense probably benign 0.12
R1523:Kifc1 UTSW 17 33883662 missense probably benign 0.23
R1818:Kifc1 UTSW 17 33884711 missense probably benign 0.02
R1958:Kifc1 UTSW 17 33884711 missense probably benign 0.02
R1960:Kifc1 UTSW 17 33884587 critical splice donor site probably null
R5439:Kifc1 UTSW 17 33886665 missense probably damaging 1.00
R5941:Kifc1 UTSW 17 33883085 splice site probably benign
R6643:Kifc1 UTSW 17 33885855 missense probably benign 0.23
R6663:Kifc1 UTSW 17 33881456 unclassified probably benign
R6724:Kifc1 UTSW 17 33886733 intron probably null
R7033:Kifc1 UTSW 17 33883697 missense probably damaging 1.00
R7498:Kifc1 UTSW 17 33883872 missense probably benign
R7515:Kifc1 UTSW 17 33884803 missense probably damaging 1.00
R7733:Kifc1 UTSW 17 33883569 missense probably damaging 1.00
R7803:Kifc1 UTSW 17 33884740 missense probably benign
R8024:Kifc1 UTSW 17 33883203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGCTCTCTCAGAGCAACACTAAG -3'
(R):5'- ACTCAAACGCTGGAACTGGAGAAC -3'

Sequencing Primer
(F):5'- TCTTCCCAAGTGCCTGAGAG -3'
(R):5'- ACTGGAGAACCGGGGTC -3'
Posted On2014-01-05