Incidental Mutation 'R1200:Akp3'
ID101269
Institutional Source Beutler Lab
Gene Symbol Akp3
Ensembl Gene ENSMUSG00000036500
Gene Namealkaline phosphatase 3, intestine, not Mn requiring
SynonymsAkp-3, IAP
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location87124973-87127912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87125260 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 57 (I57N)
Ref Sequence ENSEMBL: ENSMUSP00000037497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044878]
Predicted Effect probably damaging
Transcript: ENSMUST00000044878
AA Change: I57N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037497
Gene: ENSMUSG00000036500
AA Change: I57N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 53 487 1.92e-249 SMART
low complexity region 503 524 N/A INTRINSIC
low complexity region 533 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187662
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruption of this gene show no gross abnormalities in appearance, behavior or fertility. They do display accelerated lipid absorption on a high fat diet leading to elevated plasma triglycerides and increased weight gain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Akp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Akp3 APN 1 87127136 splice site probably benign
IGL02146:Akp3 APN 1 87126575 missense probably benign 0.00
IGL02216:Akp3 APN 1 87127650 missense probably damaging 1.00
IGL02677:Akp3 APN 1 87125272 missense probably damaging 1.00
IGL02716:Akp3 APN 1 87125479 missense probably damaging 1.00
IGL02943:Akp3 APN 1 87126369 nonsense probably null
IGL03099:Akp3 APN 1 87127606 missense probably benign 0.14
R0458:Akp3 UTSW 1 87126537 nonsense probably null
R0755:Akp3 UTSW 1 87127871 missense unknown
R0783:Akp3 UTSW 1 87127871 missense unknown
R0784:Akp3 UTSW 1 87127871 missense unknown
R1080:Akp3 UTSW 1 87127001 missense probably damaging 0.99
R1120:Akp3 UTSW 1 87125437 missense probably damaging 0.98
R1128:Akp3 UTSW 1 87127871 missense unknown
R1130:Akp3 UTSW 1 87127871 missense unknown
R1175:Akp3 UTSW 1 87127871 missense unknown
R1618:Akp3 UTSW 1 87127871 missense unknown
R1864:Akp3 UTSW 1 87127767 small deletion probably benign
R2111:Akp3 UTSW 1 87126885 intron probably null
R4657:Akp3 UTSW 1 87125834 intron probably benign
R5278:Akp3 UTSW 1 87125166 missense probably benign 0.01
R5563:Akp3 UTSW 1 87125924 missense probably damaging 1.00
R5643:Akp3 UTSW 1 87127763 missense unknown
R5768:Akp3 UTSW 1 87127122 missense probably damaging 0.99
R5809:Akp3 UTSW 1 87126548 missense probably benign 0.06
R5956:Akp3 UTSW 1 87126945 missense probably damaging 1.00
R5999:Akp3 UTSW 1 87127541 missense probably damaging 1.00
R6945:Akp3 UTSW 1 87125631 missense probably damaging 1.00
R7028:Akp3 UTSW 1 87126778 missense probably benign
R7154:Akp3 UTSW 1 87125224 missense probably damaging 0.99
R7162:Akp3 UTSW 1 87127749 missense unknown
X0018:Akp3 UTSW 1 87126338 missense probably damaging 1.00
X0060:Akp3 UTSW 1 87125894 missense probably damaging 1.00
X0066:Akp3 UTSW 1 87126796 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGGTAATGAGGCTCCTTCCAATG -3'
(R):5'- GTGGCTAAGAACTCACCTTGGACAG -3'

Sequencing Primer
(F):5'- TGAGGCTCCTTCCAATGAACAC -3'
(R):5'- GGTCCTAGATGACCTTCCAACTG -3'
Posted On2014-01-15