Incidental Mutation 'R1200:Olfr1053'
ID101277
Institutional Source Beutler Lab
Gene Symbol Olfr1053
Ensembl Gene ENSMUSG00000075192
Gene Nameolfactory receptor 1053
SynonymsGA_x6K02T2Q125-47793414-47792471, Olfr1053-ps1, MOR187-4
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86314343-86315284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86315133 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 51 (L51Q)
Ref Sequence ENSEMBL: ENSMUSP00000097481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099897]
Predicted Effect probably damaging
Transcript: ENSMUST00000099897
AA Change: L51Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097481
Gene: ENSMUSG00000075192
AA Change: L51Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-45 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Ntn5 G T 7: 45,692,382 V309L possibly damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Olfr1053
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Olfr1053 APN 2 86314944 missense probably damaging 1.00
IGL02063:Olfr1053 APN 2 86314793 missense possibly damaging 0.50
IGL02503:Olfr1053 APN 2 86314639 missense possibly damaging 0.71
IGL03342:Olfr1053 APN 2 86315235 missense possibly damaging 0.85
PIT4520001:Olfr1053 UTSW 2 86314798 missense possibly damaging 0.78
R0562:Olfr1053 UTSW 2 86314525 missense probably benign 0.00
R1026:Olfr1053 UTSW 2 86315214 missense possibly damaging 0.80
R1134:Olfr1053 UTSW 2 86315181 missense probably damaging 1.00
R1566:Olfr1053 UTSW 2 86314785 missense probably benign 0.01
R1588:Olfr1053 UTSW 2 86314530 missense probably damaging 1.00
R1747:Olfr1053 UTSW 2 86314867 missense probably benign 0.00
R1951:Olfr1053 UTSW 2 86315160 missense probably damaging 1.00
R1975:Olfr1053 UTSW 2 86315154 missense probably damaging 0.99
R2291:Olfr1053 UTSW 2 86315180 nonsense probably null
R2425:Olfr1053 UTSW 2 86314395 missense probably damaging 0.98
R5092:Olfr1053 UTSW 2 86314362 missense probably benign 0.00
R5651:Olfr1053 UTSW 2 86314440 missense probably benign 0.23
R5733:Olfr1053 UTSW 2 86315214 missense probably damaging 0.98
R5767:Olfr1053 UTSW 2 86314398 missense probably damaging 1.00
R6307:Olfr1053 UTSW 2 86315124 missense probably benign
R6720:Olfr1053 UTSW 2 86315065 missense probably damaging 0.99
R7067:Olfr1053 UTSW 2 86314567 missense probably damaging 1.00
R7289:Olfr1053 UTSW 2 86315025 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAACTGGGTAGCACATTCACAGAAAG -3'
(R):5'- AGCACACTTGACTATGGGAAAGACAC -3'

Sequencing Primer
(F):5'- CATTCACAGAAAGAAATGGTTTTGTC -3'
(R):5'- TCCAACAAGATGAAGTTGCAGTC -3'
Posted On2014-01-15