Incidental Mutation 'R1200:Ntn5'
ID101295
Institutional Source Beutler Lab
Gene Symbol Ntn5
Ensembl Gene ENSMUSG00000070564
Gene Namenetrin 5
SynonymsLOC243967
MMRRC Submission 039270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1200 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45684022-45694556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45692382 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 309 (V309L)
Ref Sequence ENSEMBL: ENSMUSP00000138144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040636] [ENSMUST00000107742] [ENSMUST00000182750] [ENSMUST00000183120]
Predicted Effect probably benign
Transcript: ENSMUST00000040636
SMART Domains Protein: ENSMUSP00000045229
Gene: ENSMUSG00000040364

DomainStartEndE-ValueType
Pfam:Glyco_transf_11 55 362 1.6e-146 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107742
AA Change: V309L

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103371
Gene: ENSMUSG00000070564
AA Change: V309L

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 115 130 N/A INTRINSIC
EGF_Lam 173 225 4.1e-2 SMART
EGF_Lam 228 275 1.75e-10 SMART
low complexity region 281 289 N/A INTRINSIC
C345C 313 432 4.71e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182750
AA Change: V240L

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138412
Gene: ENSMUSG00000070564
AA Change: V240L

DomainStartEndE-ValueType
EGF_Lam 41 93 4.1e-2 SMART
EGF_Lam 96 156 3.59e-7 SMART
EGF_Lam 159 206 1.75e-10 SMART
low complexity region 212 220 N/A INTRINSIC
C345C 244 363 4.71e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183120
AA Change: V309L

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138144
Gene: ENSMUSG00000070564
AA Change: V309L

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 115 130 N/A INTRINSIC
EGF_Lam 173 225 4.1e-2 SMART
EGF_Lam 228 275 1.75e-10 SMART
low complexity region 281 289 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit ectopic motor neurons that migrate out of the ventral horn and into the motor roots. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Acat1 T A 9: 53,583,510 I361F possibly damaging Het
Akp3 T A 1: 87,125,260 I57N probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Axin2 C A 11: 108,931,550 D309E probably damaging Het
Clstn3 G T 6: 124,459,170 P207T probably damaging Het
Dip2b C A 15: 100,209,745 A1212E probably benign Het
Dnah5 A G 15: 28,246,257 I580M possibly damaging Het
Dpp3 T C 19: 4,923,129 T146A probably benign Het
Fam227a A G 15: 79,612,537 F613S possibly damaging Het
Fam83b T C 9: 76,492,312 D503G probably damaging Het
Flot2 C T 11: 78,054,805 T2M probably damaging Het
Herc1 T C 9: 66,486,124 L4095S probably damaging Het
Kcnh7 T C 2: 62,777,395 Y614C probably damaging Het
Lcp1 T A 14: 75,229,302 F616L possibly damaging Het
Myh15 T A 16: 49,096,519 Y401N probably damaging Het
Neb T C 2: 52,167,645 Y6144C probably damaging Het
Nr1h5 A G 3: 102,947,862 F308L probably damaging Het
Olfr1053 A T 2: 86,315,133 L51Q probably damaging Het
Olfr612 T A 7: 103,539,067 T56S probably benign Het
Pex1 G A 5: 3,606,411 probably null Het
Pld1 A T 3: 28,049,286 D380V probably damaging Het
Prdm1 A G 10: 44,450,130 Y148H probably damaging Het
Ptchd3 T C 11: 121,831,261 probably null Het
Rnf17 C T 14: 56,467,706 T689I probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Twf1 A T 15: 94,586,358 H94Q probably benign Het
Vmn2r13 T G 5: 109,174,202 I210L probably damaging Het
Zbtb49 T C 5: 38,213,331 E402G probably damaging Het
Other mutations in Ntn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Ntn5 APN 7 45694247 missense probably damaging 1.00
IGL02024:Ntn5 APN 7 45691406 splice site probably benign
IGL02029:Ntn5 APN 7 45686591 missense probably benign 0.00
IGL02302:Ntn5 APN 7 45694248 missense probably damaging 1.00
IGL02676:Ntn5 APN 7 45691876 splice site probably benign
IGL02891:Ntn5 APN 7 45686224 missense probably damaging 0.99
PIT4418001:Ntn5 UTSW 7 45686501 missense probably damaging 0.97
R0179:Ntn5 UTSW 7 45686313 missense probably damaging 0.99
R0594:Ntn5 UTSW 7 45686681 missense probably damaging 0.99
R0755:Ntn5 UTSW 7 45686528 missense probably benign 0.26
R4779:Ntn5 UTSW 7 45691471 missense probably damaging 1.00
R5974:Ntn5 UTSW 7 45691424 missense probably damaging 1.00
R5978:Ntn5 UTSW 7 45694013 missense possibly damaging 0.91
R6189:Ntn5 UTSW 7 45693220 missense probably benign
R6738:Ntn5 UTSW 7 45694356 start gained probably null
R7169:Ntn5 UTSW 7 45686774 nonsense probably null
Z1088:Ntn5 UTSW 7 45694203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGCATCTCGATCAGGTAAGAGGC -3'
(R):5'- TTCCTTCCAGCTCTCAGAGAGGTCAG -3'

Sequencing Primer
(F):5'- tgtttgtttgtttgtttgtttgtttg -3'
(R):5'- TCTCAGAGAGGTCAGGCTCAAG -3'
Posted On2014-01-15