Incidental Mutation 'R3784:Prmt7'
ID272171
Institutional Source Beutler Lab
Gene Symbol Prmt7
Ensembl Gene ENSMUSG00000060098
Gene Nameprotein arginine N-methyltransferase 7
Synonyms
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106210936-106252794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106242136 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 361 (Q361K)
Ref Sequence ENSEMBL: ENSMUSP00000071521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071592]
PDB Structure
Crystal structure of mouse protein arginine methyltransferase 7 in complex with SAH [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000071592
AA Change: Q361K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000071521
Gene: ENSMUSG00000060098
AA Change: Q361K

DomainStartEndE-ValueType
Pfam:PrmA 53 148 1.6e-7 PFAM
internal_repeat_1 382 652 1.71e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000128201
SMART Domains Protein: ENSMUSP00000119992
Gene: ENSMUSG00000060098

DomainStartEndE-ValueType
Pfam:PrmA 37 132 3.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180410
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginine methylation is an apparently irreversible protein modification catalyzed by arginine methyltransferases, such as PMT7, using S-adenosylmethionine (AdoMet) as the methyl donor. Arginine methylation is implicated in signal transduction, RNA transport, and RNA splicing (Miranda et al., 2004 [PubMed 15044439]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Prmt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Prmt7 APN 8 106237214 splice site probably benign
IGL01565:Prmt7 APN 8 106250409 missense probably damaging 0.97
IGL02245:Prmt7 APN 8 106237305 missense probably benign 0.10
R0104:Prmt7 UTSW 8 106237350 missense probably damaging 0.99
R0255:Prmt7 UTSW 8 106227207 splice site probably benign
R1432:Prmt7 UTSW 8 106237284 nonsense probably null
R1551:Prmt7 UTSW 8 106237382 missense probably benign
R1848:Prmt7 UTSW 8 106237008 missense probably benign
R2117:Prmt7 UTSW 8 106227298 missense probably damaging 0.96
R4599:Prmt7 UTSW 8 106250329 missense possibly damaging 0.80
R4940:Prmt7 UTSW 8 106237278 missense probably benign 0.01
R4983:Prmt7 UTSW 8 106250363 missense probably damaging 1.00
R5285:Prmt7 UTSW 8 106248359 missense probably benign 0.15
R6015:Prmt7 UTSW 8 106235008 intron probably benign
R6520:Prmt7 UTSW 8 106234884 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCATGTATCTCCCAGGG -3'
(R):5'- AGGCTCTTAGTGTCTGCTCC -3'

Sequencing Primer
(F):5'- GGGCATCAGATCCCATTATAGATG -3'
(R):5'- CTCTTAGTGTCTGCTCCAGATGG -3'
Posted On2015-03-25