Incidental Mutation 'R3784:Olfml2b'
ID272155
Institutional Source Beutler Lab
Gene Symbol Olfml2b
Ensembl Gene ENSMUSG00000038463
Gene Nameolfactomedin-like 2B
Synonymsphotomedin-2, 1110018N05Rik, 4832415H08Rik
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170644532-170682789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 170681982 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 633 (D633G)
Ref Sequence ENSEMBL: ENSMUSP00000047291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046792]
Predicted Effect probably damaging
Transcript: ENSMUST00000046792
AA Change: D633G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047291
Gene: ENSMUSG00000038463
AA Change: D633G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 41 68 N/A INTRINSIC
coiled coil region 179 213 N/A INTRINSIC
low complexity region 233 238 N/A INTRINSIC
Blast:OLF 254 306 1e-6 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 343 382 N/A INTRINSIC
OLF 492 746 4.76e-61 SMART
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an olfactomedin domain-containing protein. Most olfactomedin domain-containing proteins are secreted glycoproteins. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Olfml2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Olfml2b APN 1 170669066 missense probably damaging 0.96
IGL01871:Olfml2b APN 1 170662355 splice site probably benign
IGL02475:Olfml2b APN 1 170682174 missense probably damaging 1.00
IGL02657:Olfml2b APN 1 170681076 missense probably benign 0.00
IGL03375:Olfml2b APN 1 170649832 missense probably benign 0.35
PIT4280001:Olfml2b UTSW 1 170647736 missense probably damaging 1.00
R0040:Olfml2b UTSW 1 170668751 missense probably benign 0.00
R0194:Olfml2b UTSW 1 170681115 missense possibly damaging 0.89
R0834:Olfml2b UTSW 1 170647844 missense probably benign 0.00
R1218:Olfml2b UTSW 1 170649782 missense probably damaging 1.00
R1386:Olfml2b UTSW 1 170681162 missense probably damaging 0.97
R1420:Olfml2b UTSW 1 170669027 missense probably benign 0.01
R1699:Olfml2b UTSW 1 170645073 missense possibly damaging 0.89
R1730:Olfml2b UTSW 1 170681789 missense probably damaging 1.00
R1755:Olfml2b UTSW 1 170681777 missense probably damaging 1.00
R1869:Olfml2b UTSW 1 170669243 missense probably damaging 0.96
R2295:Olfml2b UTSW 1 170662538 splice site probably benign
R2394:Olfml2b UTSW 1 170649750 missense possibly damaging 0.82
R4523:Olfml2b UTSW 1 170669222 missense probably benign
R4611:Olfml2b UTSW 1 170644947 missense probably damaging 0.99
R4900:Olfml2b UTSW 1 170662378 missense probably damaging 1.00
R5201:Olfml2b UTSW 1 170668864 missense probably benign
R5245:Olfml2b UTSW 1 170668874 missense probably benign
R5268:Olfml2b UTSW 1 170649761 missense probably damaging 1.00
R5283:Olfml2b UTSW 1 170681189 nonsense probably null
R5348:Olfml2b UTSW 1 170662426 missense probably benign 0.02
R5408:Olfml2b UTSW 1 170644976 missense probably damaging 1.00
R5673:Olfml2b UTSW 1 170682129 missense probably damaging 1.00
R5758:Olfml2b UTSW 1 170669264 critical splice donor site probably null
R5893:Olfml2b UTSW 1 170662473 missense probably benign
R6290:Olfml2b UTSW 1 170649790 nonsense probably null
R6380:Olfml2b UTSW 1 170669231 missense probably benign 0.00
R6778:Olfml2b UTSW 1 170645070 missense probably damaging 1.00
R7155:Olfml2b UTSW 1 170666785 missense probably benign 0.01
R7538:Olfml2b UTSW 1 170649833 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATACAGCTGGATTGGCACGG -3'
(R):5'- AGATGTTGGCATTCCTCTGG -3'

Sequencing Primer
(F):5'- GCGCCTTCTACTATAACCGGG -3'
(R):5'- CTCTGGTTATAGCTGTCCACAG -3'
Posted On2015-03-25