Incidental Mutation 'R3784:Pmepa1'
ID272160
Institutional Source Beutler Lab
Gene Symbol Pmepa1
Ensembl Gene ENSMUSG00000038400
Gene Nameprostate transmembrane protein, androgen induced 1
SynonymsN4wbp4, Tmepai, 2210418I02Rik, PMEPA1, STAG1
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location173224458-173276533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 173228133 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 210 (R210W)
Ref Sequence ENSEMBL: ENSMUSP00000115534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036248] [ENSMUST00000139306]
Predicted Effect probably damaging
Transcript: ENSMUST00000036248
AA Change: R172W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039950
Gene: ENSMUSG00000038400
AA Change: R172W

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124124
Predicted Effect probably damaging
Transcript: ENSMUST00000139306
AA Change: R210W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115534
Gene: ENSMUSG00000038400
AA Change: R210W

DomainStartEndE-ValueType
transmembrane domain 75 97 N/A INTRINSIC
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains a Smad interacting motif (SIM). Expression of this gene is induced by androgens and transforming growth factor beta, and the encoded protein suppresses the androgen receptor and transforming growth factor beta signaling pathways though interactions with Smad proteins. Overexpression of this gene may play a role in multiple types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Pmepa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1401:Pmepa1 UTSW 2 173228575 critical splice donor site probably null
R1439:Pmepa1 UTSW 2 173228081 missense probably benign 0.13
R1772:Pmepa1 UTSW 2 173234360 missense probably damaging 1.00
R2228:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2229:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2380:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2381:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2382:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2385:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2386:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3783:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3785:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3787:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R4600:Pmepa1 UTSW 2 173228327 missense possibly damaging 0.81
R5368:Pmepa1 UTSW 2 173228322 missense probably damaging 1.00
R5982:Pmepa1 UTSW 2 173234312 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AATGACCTCGCTGTAGGTGG -3'
(R):5'- AACTCAGTCTCTGAATCTGGGG -3'

Sequencing Primer
(F):5'- CAGCATGGTGCTGTCTA -3'
(R):5'- TCTCTGAATCTGGGGGAATCCAAC -3'
Posted On2015-03-25