Incidental Mutation 'R4028:Anapc2'
ID313074
Institutional Source Beutler Lab
Gene Symbol Anapc2
Ensembl Gene ENSMUSG00000026965
Gene Nameanaphase promoting complex subunit 2
SynonymsEmi4, 9230107K09Rik, Imi4, expressed during mesenchymal induction 4, APC2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4028 (G1)
Quality Score142
Status Not validated
Chromosome2
Chromosomal Location25272478-25285915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25277738 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 439 (I439N)
Ref Sequence ENSEMBL: ENSMUSP00000028341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028341] [ENSMUST00000129300]
Predicted Effect probably damaging
Transcript: ENSMUST00000028341
AA Change: I439N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028341
Gene: ENSMUSG00000026965
AA Change: I439N

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 123 133 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
low complexity region 456 467 N/A INTRINSIC
CULLIN 515 663 6.72e-9 SMART
APC2 772 832 3.67e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129265
Predicted Effect probably damaging
Transcript: ENSMUST00000129300
AA Change: I153N

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115177
Gene: ENSMUSG00000026965
AA Change: I153N

DomainStartEndE-ValueType
low complexity region 170 181 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle by ubiquitinating its specific substrates, such as mitotic cyclins and anaphase inhibitor, for subsequent degradation by the proteasome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before E6.5. Conditional ablation in the liver results in liver failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Anapc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Anapc2 APN 2 25274782 missense possibly damaging 0.65
IGL01575:Anapc2 APN 2 25285176 splice site probably benign
IGL01993:Anapc2 APN 2 25274713 missense probably benign 0.00
IGL02586:Anapc2 APN 2 25285096 missense probably benign 0.08
IGL02721:Anapc2 APN 2 25274668 nonsense probably null
FR4976:Anapc2 UTSW 2 25272532 unclassified probably benign
R0415:Anapc2 UTSW 2 25278325 missense probably damaging 1.00
R1539:Anapc2 UTSW 2 25273063 missense probably benign
R1675:Anapc2 UTSW 2 25272639 missense possibly damaging 0.88
R1720:Anapc2 UTSW 2 25274712 missense probably benign 0.13
R2150:Anapc2 UTSW 2 25272670 missense probably benign 0.27
R2173:Anapc2 UTSW 2 25273276 missense probably benign 0.01
R4254:Anapc2 UTSW 2 25273345 missense probably benign 0.08
R4643:Anapc2 UTSW 2 25276394 missense probably benign
R4742:Anapc2 UTSW 2 25273543 splice site probably null
R4824:Anapc2 UTSW 2 25277752 missense probably damaging 1.00
R5039:Anapc2 UTSW 2 25274796 missense possibly damaging 0.70
R5530:Anapc2 UTSW 2 25284583 missense possibly damaging 0.81
R6456:Anapc2 UTSW 2 25280195 missense probably damaging 1.00
R6479:Anapc2 UTSW 2 25285395 missense probably benign 0.04
R6587:Anapc2 UTSW 2 25272538 unclassified probably benign
X0025:Anapc2 UTSW 2 25279278 missense probably benign 0.01
Z1088:Anapc2 UTSW 2 25273368 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCCAAGCTGCCCATTCAG -3'
(R):5'- CACACAGCTTGACACTGTGC -3'

Sequencing Primer
(F):5'- AAGCTGCCCATTCAGGAGGTG -3'
(R):5'- TGTGCAACAGAGTGGACAACTAC -3'
Posted On2015-04-30