Incidental Mutation 'R4028:Ntrk3'
ID313088
Institutional Source Beutler Lab
Gene Symbol Ntrk3
Ensembl Gene ENSMUSG00000059146
Gene Nameneurotrophic tyrosine kinase, receptor, type 3
SynonymsTrkC
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location78175959-78738012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78192710 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 790 (E790G)
Ref Sequence ENSEMBL: ENSMUSP00000141534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000193002] [ENSMUST00000195262]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039431
AA Change: E776G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146
AA Change: E776G

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 810 1.49e-145 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193002
AA Change: E790G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146
AA Change: E790G

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
Pfam:Ig_2 312 392 6.9e-4 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 824 4.29e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195262
AA Change: E815G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146
AA Change: E815G

DomainStartEndE-ValueType
LRRNT 31 63 1.2e-6 SMART
LRRCT 160 208 1.8e-14 SMART
IG 216 302 5.1e-11 SMART
Pfam:I-set 308 392 4.7e-7 PFAM
Pfam:Ig_2 312 392 1.3e-2 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 849 9.7e-132 SMART
Predicted Effect unknown
Transcript: ENSMUST00000205354
AA Change: E11G
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Ntrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Ntrk3 APN 7 78250873 missense probably benign 0.03
IGL00862:Ntrk3 APN 7 78247177 missense probably damaging 1.00
IGL00972:Ntrk3 APN 7 78247322 missense possibly damaging 0.95
IGL00976:Ntrk3 APN 7 78450953 missense probably benign 0.02
IGL02172:Ntrk3 APN 7 78460272 splice site probably benign
IGL02175:Ntrk3 APN 7 78247228 missense probably damaging 1.00
IGL02213:Ntrk3 APN 7 78462931 missense probably benign 0.17
IGL02363:Ntrk3 APN 7 78453337 missense probably benign 0.24
IGL02527:Ntrk3 APN 7 78451949 missense probably benign
IGL02673:Ntrk3 APN 7 78250764 missense probably damaging 1.00
IGL02755:Ntrk3 APN 7 78460439 missense probably benign
IGL02998:Ntrk3 APN 7 78577657 missense probably damaging 0.98
IGL03235:Ntrk3 APN 7 78192592 missense probably damaging 1.00
R1465:Ntrk3 UTSW 7 78356014 splice site probably benign
R1505:Ntrk3 UTSW 7 78460524 missense probably damaging 0.99
R1638:Ntrk3 UTSW 7 78247288 missense probably damaging 1.00
R1641:Ntrk3 UTSW 7 78356074 missense probably damaging 1.00
R1775:Ntrk3 UTSW 7 78356041 missense possibly damaging 0.60
R1786:Ntrk3 UTSW 7 78477935 splice site probably benign
R1827:Ntrk3 UTSW 7 78247301 missense probably damaging 1.00
R1868:Ntrk3 UTSW 7 78192604 missense possibly damaging 0.90
R1873:Ntrk3 UTSW 7 78462839 missense probably benign
R1929:Ntrk3 UTSW 7 78516723 splice site probably null
R1941:Ntrk3 UTSW 7 78247262 missense probably damaging 1.00
R2132:Ntrk3 UTSW 7 78477935 splice site probably benign
R2214:Ntrk3 UTSW 7 78516772 missense probably damaging 1.00
R2221:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2223:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2271:Ntrk3 UTSW 7 78516723 splice site probably null
R2441:Ntrk3 UTSW 7 78302662 missense probably damaging 1.00
R3108:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3109:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3959:Ntrk3 UTSW 7 78198842 missense probably damaging 1.00
R4016:Ntrk3 UTSW 7 78462947 splice site probably benign
R4067:Ntrk3 UTSW 7 78517437 missense probably damaging 1.00
R4398:Ntrk3 UTSW 7 78250769 nonsense probably null
R4664:Ntrk3 UTSW 7 78461099 missense probably damaging 0.99
R5045:Ntrk3 UTSW 7 78460424 missense probably benign 0.13
R5081:Ntrk3 UTSW 7 78577774 missense probably damaging 0.99
R5151:Ntrk3 UTSW 7 78247300 missense probably damaging 1.00
R5249:Ntrk3 UTSW 7 78461166 missense possibly damaging 0.87
R5294:Ntrk3 UTSW 7 78517506 splice site probably null
R5594:Ntrk3 UTSW 7 78451899 missense probably benign 0.10
R5923:Ntrk3 UTSW 7 78451928 missense possibly damaging 0.61
R6878:Ntrk3 UTSW 7 78304372 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGCTTGGCCACCAGTCAC -3'
(R):5'- AGCAGCAGTAAGTAAGATCCAC -3'

Sequencing Primer
(F):5'- CCACTAGCCAAGAATGTCCAGGTAG -3'
(R):5'- AACCAGACTTCTGCCTGTGTG -3'
Posted On2015-04-30