Incidental Mutation 'R4429:Hap1'
ID328338
Institutional Source Beutler Lab
Gene Symbol Hap1
Ensembl Gene ENSMUSG00000006930
Gene Namehuntingtin-associated protein 1
SynonymsHAP-1
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.500) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100347327-100356128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100354272 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 38 (T38A)
Ref Sequence ENSEMBL: ENSMUSP00000134625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103124] [ENSMUST00000138603] [ENSMUST00000146878] [ENSMUST00000174635]
Predicted Effect probably benign
Transcript: ENSMUST00000103124
AA Change: T186A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099413
Gene: ENSMUSG00000006930
AA Change: T186A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:HAP1_N 79 403 5e-111 PFAM
low complexity region 481 499 N/A INTRINSIC
low complexity region 506 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138603
AA Change: T186A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133356
Gene: ENSMUSG00000006930
AA Change: T186A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:HAP1_N 80 402 1.4e-109 PFAM
low complexity region 481 499 N/A INTRINSIC
low complexity region 506 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146878
AA Change: T38A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134625
Gene: ENSMUSG00000006930
AA Change: T38A

DomainStartEndE-ValueType
Pfam:HAP1_N 1 181 2.2e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173304
Predicted Effect probably benign
Transcript: ENSMUST00000173630
SMART Domains Protein: ENSMUSP00000134050
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
Pfam:HAP1_N 1 177 1e-46 PFAM
low complexity region 250 268 N/A INTRINSIC
low complexity region 275 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174635
SMART Domains Protein: ENSMUSP00000133831
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
low complexity region 119 137 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene was first identified as a neuronal protein that binds the HD protein huntingtin. The protein also interacts with kinesin light chain, 14-3-3 proteins, and Abelson helper integration site 1 protein. The protein is involved in intracellular trafficking of vesicles and organelles, and lack of the protein results in neuronal death resembling the hypothalamic degeneration that occurs in Huntington's disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene results in abnormal feeding and/or suckling behavior, absent gastric milk in neonates, slow postnatal weight gain, and postnatal death. Degeneration in hypothalamic regions that control feeding behavior has been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Hap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Hap1 APN 11 100349548 missense probably benign 0.00
IGL01320:Hap1 APN 11 100349380 missense probably damaging 0.96
IGL01790:Hap1 APN 11 100351906 unclassified probably null
IGL01949:Hap1 APN 11 100348762 missense probably damaging 0.96
IGL02325:Hap1 APN 11 100354364 critical splice acceptor site probably null
IGL03399:Hap1 APN 11 100354267 missense possibly damaging 0.90
R0346:Hap1 UTSW 11 100356029 missense probably benign
R0463:Hap1 UTSW 11 100349305 missense probably damaging 1.00
R0608:Hap1 UTSW 11 100349305 missense probably damaging 1.00
R1112:Hap1 UTSW 11 100354317 missense probably damaging 1.00
R1682:Hap1 UTSW 11 100349476 missense possibly damaging 0.46
R1952:Hap1 UTSW 11 100352279 missense probably damaging 1.00
R2079:Hap1 UTSW 11 100353746 missense probably damaging 1.00
R2088:Hap1 UTSW 11 100356002 missense probably benign
R2112:Hap1 UTSW 11 100353999 missense probably benign 0.28
R2211:Hap1 UTSW 11 100354724 missense probably benign 0.21
R2354:Hap1 UTSW 11 100354715 missense probably damaging 1.00
R3829:Hap1 UTSW 11 100356021 missense probably damaging 0.99
R4259:Hap1 UTSW 11 100351842 critical splice donor site probably null
R4585:Hap1 UTSW 11 100354724 missense probably benign 0.21
R4586:Hap1 UTSW 11 100354724 missense probably benign 0.21
R5085:Hap1 UTSW 11 100355711 missense probably damaging 1.00
R5133:Hap1 UTSW 11 100351531 missense probably benign 0.00
R5762:Hap1 UTSW 11 100355774 missense probably damaging 1.00
R6118:Hap1 UTSW 11 100355794 missense probably benign 0.24
R6148:Hap1 UTSW 11 100349392 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCATCTCGCAGGTTCAC -3'
(R):5'- CAGAGGACCAATCTGGACTGATC -3'

Sequencing Primer
(F):5'- CCTGCTTCCGGAGATGTAAAATC -3'
(R):5'- GAGGACCAATCTGGACTGATCTTATC -3'
Posted On2015-07-07