Incidental Mutation 'R0064:Cic'
ID 34400
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Name capicua transcriptional repressor
Synonyms 1200010B10Rik
MMRRC Submission 038356-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R0064 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 24967129-24993584 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 24986566 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Tyrosine at position 1299 (S1299Y)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]
AlphaFold Q924A2
Predicted Effect probably benign
Transcript: ENSMUST00000005578
AA Change: S392Y

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: S392Y

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1155 N/A INTRINSIC
low complexity region 1223 1253 N/A INTRINSIC
low complexity region 1280 1313 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163320
AA Change: S392Y

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: S392Y

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1064 1079 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
low complexity region 1134 1154 N/A INTRINSIC
low complexity region 1222 1252 N/A INTRINSIC
low complexity region 1279 1312 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164440
Predicted Effect probably benign
Transcript: ENSMUST00000164820
SMART Domains Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165239
AA Change: S392Y

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: S392Y

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 5e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165742
Predicted Effect probably damaging
Transcript: ENSMUST00000169266
AA Change: S1299Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: S1299Y

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169743
Meta Mutation Damage Score 0.0659 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,035,698 (GRCm39) L641M probably damaging Het
Abca9 A C 11: 110,035,697 (GRCm39) L641R probably damaging Het
Abhd18 A G 3: 40,888,288 (GRCm39) I377M probably benign Het
Arhgef17 C A 7: 100,530,561 (GRCm39) M1408I probably benign Het
Bcl2a1a G C 9: 88,839,516 (GRCm39) G138A probably damaging Het
C4b A G 17: 34,957,830 (GRCm39) L617P probably damaging Het
Ccdc25 T A 14: 66,091,561 (GRCm39) I60K possibly damaging Het
Cdk1 T C 10: 69,180,907 (GRCm39) D101G probably benign Het
Cdon A G 9: 35,400,523 (GRCm39) H1079R probably benign Het
Cep126 A T 9: 8,130,183 (GRCm39) probably benign Het
Clstn1 G A 4: 149,719,253 (GRCm39) V361M probably damaging Het
Crlf3 A G 11: 79,948,728 (GRCm39) I239T possibly damaging Het
Cstf2t T A 19: 31,060,699 (GRCm39) N78K probably damaging Het
Cul1 A G 6: 47,479,349 (GRCm39) probably benign Het
D430041D05Rik T G 2: 104,079,502 (GRCm39) T1194P probably damaging Het
Fbp2 A T 13: 63,001,862 (GRCm39) F118I probably damaging Het
Fbxw14 A T 9: 109,116,660 (GRCm39) Y16* probably null Het
Fgd3 T G 13: 49,449,901 (GRCm39) D116A possibly damaging Het
Gm7168 C T 17: 14,170,121 (GRCm39) T496I probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Klhl5 T A 5: 65,298,631 (GRCm39) S137T probably benign Het
Knl1 T A 2: 118,906,724 (GRCm39) N1604K probably benign Het
Lpcat1 T A 13: 73,662,585 (GRCm39) N463K probably damaging Het
Lpl A G 8: 69,345,356 (GRCm39) H120R probably damaging Het
Man1a2 A T 3: 100,499,199 (GRCm39) S412T possibly damaging Het
Mcc C G 18: 44,652,583 (GRCm39) probably benign Het
Myo18a G T 11: 77,738,170 (GRCm39) R1704L probably damaging Het
Nlrc3 G T 16: 3,781,951 (GRCm39) T486K possibly damaging Het
Nrip1 T A 16: 76,091,558 (GRCm39) probably benign Het
Nutf2 A G 8: 106,605,441 (GRCm39) D92G probably damaging Het
Obscn A C 11: 58,918,292 (GRCm39) V6260G probably damaging Het
Or10a2 T C 7: 106,673,487 (GRCm39) F151L probably benign Het
Or2ak7 G A 11: 58,575,301 (GRCm39) V201M probably benign Het
Plce1 T C 19: 38,769,228 (GRCm39) probably null Het
Pmpca C A 2: 26,285,519 (GRCm39) D498E probably benign Het
Pnpla7 G T 2: 24,887,239 (GRCm39) E28* probably null Het
Polg C A 7: 79,111,632 (GRCm39) W206C probably damaging Het
Ptprt C T 2: 161,769,711 (GRCm39) probably benign Het
Slc7a14 T C 3: 31,281,209 (GRCm39) D367G probably damaging Het
Spata31 T C 13: 65,069,912 (GRCm39) Y687H probably damaging Het
Sybu T A 15: 44,536,389 (GRCm39) T646S probably benign Het
Thbs1 A T 2: 117,954,395 (GRCm39) probably null Het
Tie1 A G 4: 118,346,898 (GRCm39) V2A possibly damaging Het
Tma16 A T 8: 66,929,457 (GRCm39) I179K possibly damaging Het
Tns3 G A 11: 8,385,856 (GRCm39) Q1381* probably null Het
Trank1 A G 9: 111,172,263 (GRCm39) D84G probably damaging Het
Ttc3 A T 16: 94,223,106 (GRCm39) H197L possibly damaging Het
Urb1 A G 16: 90,576,028 (GRCm39) F843L probably benign Het
Vmn1r24 T G 6: 57,933,003 (GRCm39) I172L probably benign Het
Vmn2r1 T A 3: 64,012,209 (GRCm39) I690N possibly damaging Het
Vmn2r111 T A 17: 22,791,053 (GRCm39) I82L probably benign Het
Zfp287 A T 11: 62,605,764 (GRCm39) L370H possibly damaging Het
Zfp608 A T 18: 55,031,888 (GRCm39) I684N probably benign Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 24,991,549 (GRCm39) missense probably damaging 1.00
IGL01668:Cic APN 7 24,990,629 (GRCm39) missense possibly damaging 0.47
IGL02229:Cic APN 7 24,990,375 (GRCm39) missense probably damaging 0.96
IGL02506:Cic APN 7 24,990,282 (GRCm39) missense probably benign
IGL02794:Cic APN 7 24,985,069 (GRCm39) missense probably damaging 1.00
IGL03065:Cic APN 7 24,985,246 (GRCm39) splice site probably benign
IGL03304:Cic APN 7 24,984,274 (GRCm39) missense probably damaging 1.00
Capuccino UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
Cassock UTSW 7 24,988,338 (GRCm39) nonsense probably null
Monkey UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R4850_Cic_466 UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
1mM(1):Cic UTSW 7 24,990,214 (GRCm39) splice site probably benign
IGL03046:Cic UTSW 7 24,990,500 (GRCm39) missense probably damaging 1.00
R0012:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0012:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0027:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0027:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0038:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0038:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0063:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0063:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0064:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0118:Cic UTSW 7 24,985,459 (GRCm39) missense probably damaging 1.00
R0193:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0193:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0241:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0241:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0377:Cic UTSW 7 24,985,224 (GRCm39) missense probably damaging 0.98
R0462:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0462:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0800:Cic UTSW 7 24,984,662 (GRCm39) missense probably benign
R1253:Cic UTSW 7 24,990,373 (GRCm39) missense probably damaging 1.00
R1458:Cic UTSW 7 24,979,162 (GRCm39) intron probably benign
R1462:Cic UTSW 7 24,971,032 (GRCm39) missense probably damaging 0.98
R1462:Cic UTSW 7 24,971,032 (GRCm39) missense probably damaging 0.98
R1519:Cic UTSW 7 24,993,235 (GRCm39) critical splice acceptor site probably null
R1586:Cic UTSW 7 24,985,386 (GRCm39) missense probably damaging 1.00
R1824:Cic UTSW 7 24,987,691 (GRCm39) missense probably damaging 1.00
R1908:Cic UTSW 7 24,986,265 (GRCm39) missense probably damaging 1.00
R2045:Cic UTSW 7 24,970,961 (GRCm39) missense possibly damaging 0.53
R2063:Cic UTSW 7 24,972,876 (GRCm39) missense probably damaging 0.98
R2161:Cic UTSW 7 24,987,559 (GRCm39) splice site probably null
R2495:Cic UTSW 7 24,991,201 (GRCm39) splice site probably benign
R2865:Cic UTSW 7 24,972,646 (GRCm39) missense probably damaging 0.96
R3692:Cic UTSW 7 24,988,338 (GRCm39) nonsense probably null
R3709:Cic UTSW 7 24,986,406 (GRCm39) missense probably damaging 0.99
R3710:Cic UTSW 7 24,986,406 (GRCm39) missense probably damaging 0.99
R3872:Cic UTSW 7 24,971,124 (GRCm39) missense possibly damaging 0.92
R3946:Cic UTSW 7 24,971,771 (GRCm39) missense possibly damaging 0.93
R4199:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4426:Cic UTSW 7 24,993,433 (GRCm39) utr 3 prime probably benign
R4502:Cic UTSW 7 24,987,892 (GRCm39) missense probably damaging 1.00
R4585:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R4586:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R4614:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4664:Cic UTSW 7 24,990,099 (GRCm39) small deletion probably benign
R4688:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4695:Cic UTSW 7 24,973,013 (GRCm39) missense possibly damaging 0.72
R4696:Cic UTSW 7 24,987,908 (GRCm39) missense probably benign
R4746:Cic UTSW 7 24,987,905 (GRCm39) missense probably damaging 1.00
R4758:Cic UTSW 7 24,991,636 (GRCm39) missense possibly damaging 0.62
R4767:Cic UTSW 7 24,971,025 (GRCm39) missense possibly damaging 0.92
R4776:Cic UTSW 7 24,982,308 (GRCm39) missense possibly damaging 0.95
R4820:Cic UTSW 7 24,971,157 (GRCm39) missense possibly damaging 0.92
R4850:Cic UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
R4851:Cic UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
R4922:Cic UTSW 7 24,991,095 (GRCm39) small insertion probably benign
R4989:Cic UTSW 7 24,986,535 (GRCm39) missense probably damaging 1.00
R5131:Cic UTSW 7 24,991,095 (GRCm39) small insertion probably benign
R5718:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R5801:Cic UTSW 7 24,970,863 (GRCm39) missense possibly damaging 0.93
R5949:Cic UTSW 7 24,971,730 (GRCm39) missense probably damaging 1.00
R6000:Cic UTSW 7 24,971,423 (GRCm39) missense probably benign 0.33
R6246:Cic UTSW 7 24,971,067 (GRCm39) missense probably damaging 1.00
R6283:Cic UTSW 7 24,985,459 (GRCm39) missense probably damaging 1.00
R6364:Cic UTSW 7 24,972,248 (GRCm39) missense possibly damaging 0.72
R6481:Cic UTSW 7 24,987,706 (GRCm39) missense possibly damaging 0.56
R6919:Cic UTSW 7 24,971,202 (GRCm39) missense probably benign 0.04
R6920:Cic UTSW 7 24,990,107 (GRCm39) missense probably damaging 1.00
R6995:Cic UTSW 7 24,970,736 (GRCm39) missense possibly damaging 0.53
R7002:Cic UTSW 7 24,971,621 (GRCm39) missense probably damaging 0.99
R7113:Cic UTSW 7 24,972,869 (GRCm39) missense probably benign 0.08
R7560:Cic UTSW 7 24,972,278 (GRCm39) missense probably damaging 0.98
R7680:Cic UTSW 7 24,991,856 (GRCm39) missense probably damaging 0.96
R7698:Cic UTSW 7 24,972,597 (GRCm39) missense possibly damaging 0.72
R7746:Cic UTSW 7 24,988,207 (GRCm39) missense probably damaging 1.00
R7841:Cic UTSW 7 24,985,192 (GRCm39) missense probably damaging 1.00
R7879:Cic UTSW 7 24,984,551 (GRCm39) missense probably benign 0.10
R7916:Cic UTSW 7 24,987,715 (GRCm39) missense probably damaging 0.99
R7920:Cic UTSW 7 24,971,384 (GRCm39) missense probably benign
R8056:Cic UTSW 7 24,990,366 (GRCm39) missense possibly damaging 0.90
R8226:Cic UTSW 7 24,987,213 (GRCm39) missense probably damaging 1.00
R8281:Cic UTSW 7 24,971,249 (GRCm39) missense probably benign
R8847:Cic UTSW 7 24,970,631 (GRCm39) missense probably damaging 0.98
R8991:Cic UTSW 7 24,988,885 (GRCm39) missense probably damaging 1.00
R9083:Cic UTSW 7 24,985,470 (GRCm39) missense probably damaging 0.99
R9140:Cic UTSW 7 24,985,165 (GRCm39) missense probably damaging 0.99
R9200:Cic UTSW 7 24,971,940 (GRCm39) missense probably damaging 0.99
R9208:Cic UTSW 7 24,987,502 (GRCm39) missense probably benign 0.07
R9301:Cic UTSW 7 24,991,117 (GRCm39) missense probably damaging 1.00
R9408:Cic UTSW 7 24,971,414 (GRCm39) missense possibly damaging 0.70
R9569:Cic UTSW 7 24,972,120 (GRCm39) missense possibly damaging 0.85
R9752:Cic UTSW 7 24,971,403 (GRCm39) missense probably damaging 0.96
V7732:Cic UTSW 7 24,991,670 (GRCm39) missense probably benign
Z1176:Cic UTSW 7 24,970,444 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCTTGATGGTGGGGAAGTAGACAGC -3'
(R):5'- ACCTGAAGCCGTACACTAGGAAGAG -3'

Sequencing Primer
(F):5'- GTAGACAGCCAAGCACTTCAAG -3'
(R):5'- TCCGTGGCTGAAGTATATCCAAC -3'
Posted On 2013-05-09