Incidental Mutation 'R5553:Selenon'
ID435216
Institutional Source Beutler Lab
Gene Symbol Selenon
Ensembl Gene ENSMUSG00000050989
Gene Nameselenoprotein N
SynonymsSepn1, 1110019I12Rik
MMRRC Submission 043110-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5553 (G1)
Quality Score223
Status Not validated
Chromosome4
Chromosomal Location134537892-134552166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 134540917 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 435 (R435L)
Ref Sequence ENSEMBL: ENSMUSP00000060026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060435]
Predicted Effect probably damaging
Transcript: ENSMUST00000060435
AA Change: R435L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060026
Gene: ENSMUSG00000050989
AA Change: R435L

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1k94a_ 76 113 4e-3 SMART
low complexity region 160 179 N/A INTRINSIC
low complexity region 526 532 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127585
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is localized in the endoplasmic reticulum. It plays an important role in cell protection against oxidative stress, and in the regulation of redox-related calcium homeostasis. Mutations in the orthologous gene in human are associated with early onset muscle disorders, referred to as SEPN1-related myopathy. Knockout mice deleted for this gene exhibit abnormal lung development. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. A second stop-codon redefinition element (SRE) adjacent to the UGA codon has been identified in this gene (PMID:15791204). SRE is a phylogenetically conserved stem-loop structure that stimulates readthrough at the UGA codon, and augments the Sec insertion efficiency by SECIS. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit satellite cell loss and impaired muscle regeneration. Mice homozygous for a different knock-out allele exhibit subtle core lesions in skeletal muscle after induced oxidative stress and abnormal lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Irf4 A G 13: 30,751,828 Y122C probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Selenon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Selenon APN 4 134539726 unclassified probably benign
IGL02832:Selenon APN 4 134540908 missense probably damaging 1.00
IGL03015:Selenon APN 4 134545518 missense probably benign 0.43
I0000:Selenon UTSW 4 134542701 splice site probably benign
R1400:Selenon UTSW 4 134551518 missense probably benign 0.00
R1436:Selenon UTSW 4 134540686 missense probably damaging 1.00
R1932:Selenon UTSW 4 134544618 missense probably damaging 0.99
R2886:Selenon UTSW 4 134543069 missense probably null 1.00
R3884:Selenon UTSW 4 134539770 missense possibly damaging 0.80
R4647:Selenon UTSW 4 134545657 missense probably damaging 1.00
R4721:Selenon UTSW 4 134543076 nonsense probably null
R5091:Selenon UTSW 4 134547973 missense probably damaging 1.00
R5412:Selenon UTSW 4 134542438 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATACTTCCTGGTATCTGGGCC -3'
(R):5'- TGTCCATGCTGATCCTACAAC -3'

Sequencing Primer
(F):5'- TATCTGGGCCCAGTGCTGTC -3'
(R):5'- AGCCTCCTGAGTGCTAGGATAC -3'
Posted On2016-10-24