Incidental Mutation '0152:Pkhd1'
ID 13
Institutional Source Beutler Lab
Gene Symbol Pkhd1
Ensembl Gene ENSMUSG00000043760
Gene Name polycystic kidney and hepatic disease 1
Synonyms FPC, tigmin
Accession Numbers

Genbank: NM_153179; MGI: 2155808

Essential gene? Probably non essential (E-score: 0.121) question?
Stock # 0152 of strain feeble
Quality Score
Status Validated
Chromosome 1
Chromosomal Location 20057779-20618064 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 20522894 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 1665 (I1665S)
Ref Sequence ENSEMBL: ENSMUSP00000085794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088448]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000088448
AA Change: I1665S

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: I1665S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IPT 134 254 1e-45 BLAST
IPT 256 353 1.13e-3 SMART
low complexity region 722 743 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Pfam:TIG 936 1005 9.1e-8 PFAM
IPT 1016 1101 1.18e-6 SMART
IPT 1105 1190 1.27e0 SMART
IPT 1193 1290 7.05e-5 SMART
IPT 1384 1467 1.36e1 SMART
IPT 1568 1655 2.4e0 SMART
low complexity region 1881 1892 N/A INTRINSIC
G8 1928 2049 1.15e-48 SMART
low complexity region 2079 2094 N/A INTRINSIC
PbH1 2244 2266 7.82e3 SMART
PbH1 2287 2321 2.23e3 SMART
PbH1 2404 2426 7.19e2 SMART
PbH1 2459 2481 2.64e2 SMART
low complexity region 2713 2728 N/A INTRINSIC
G8 2734 2867 1.73e-43 SMART
Blast:G8 2876 2923 2e-17 BLAST
PbH1 3004 3026 3.98e3 SMART
PbH1 3027 3049 1.27e0 SMART
PbH1 3080 3102 5.92e2 SMART
low complexity region 3178 3187 N/A INTRINSIC
PbH1 3188 3212 8.08e3 SMART
transmembrane domain 3852 3874 N/A INTRINSIC
Meta Mutation Damage Score 0.4236 question?
Coding Region Coverage
  • 1x: 77.9%
  • 3x: 41.0%
Validation Efficiency 83% (65/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 6 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A T 12: 88,431,151 (GRCm38) Q185L probably benign Het
Fscn3 A G 6: 28,429,967 (GRCm38) probably benign Homo
Per1 T G 11: 69,104,022 (GRCm38) probably benign Het
Tnrc6a C A 7: 123,180,654 (GRCm38) P1303T probably damaging Het
Usp47 T C 7: 112,056,577 (GRCm38) Y154H probably damaging Het
Zfp952 T A 17: 33,003,221 (GRCm38) probably null Het
Other mutations in Pkhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pkhd1 APN 1 20,566,874 (GRCm38) critical splice acceptor site probably null
IGL00687:Pkhd1 APN 1 20,524,070 (GRCm38) missense probably benign 0.19
IGL00824:Pkhd1 APN 1 20,081,184 (GRCm38) critical splice donor site probably null
IGL00870:Pkhd1 APN 1 20,571,390 (GRCm38) missense probably damaging 1.00
IGL00911:Pkhd1 APN 1 20,117,747 (GRCm38) missense probably benign 0.00
IGL01015:Pkhd1 APN 1 20,523,258 (GRCm38) missense possibly damaging 0.95
IGL01025:Pkhd1 APN 1 20,209,176 (GRCm38) missense probably benign 0.04
IGL01064:Pkhd1 APN 1 20,534,530 (GRCm38) splice site probably benign
IGL01313:Pkhd1 APN 1 20,201,024 (GRCm38) missense probably damaging 1.00
IGL01340:Pkhd1 APN 1 20,522,977 (GRCm38) missense probably benign 0.01
IGL01352:Pkhd1 APN 1 20,549,715 (GRCm38) missense probably benign 0.34
IGL01456:Pkhd1 APN 1 20,199,459 (GRCm38) missense probably damaging 1.00
IGL01530:Pkhd1 APN 1 20,559,419 (GRCm38) critical splice donor site probably null
IGL01557:Pkhd1 APN 1 20,116,979 (GRCm38) missense possibly damaging 0.59
IGL01655:Pkhd1 APN 1 20,534,633 (GRCm38) nonsense probably null
IGL01790:Pkhd1 APN 1 20,558,671 (GRCm38) missense probably damaging 0.96
IGL01862:Pkhd1 APN 1 20,358,910 (GRCm38) missense probably damaging 1.00
IGL01874:Pkhd1 APN 1 20,103,235 (GRCm38) missense probably benign 0.32
IGL01901:Pkhd1 APN 1 20,220,083 (GRCm38) missense probably benign 0.11
IGL01903:Pkhd1 APN 1 20,198,137 (GRCm38) missense probably damaging 1.00
IGL01981:Pkhd1 APN 1 20,523,567 (GRCm38) missense possibly damaging 0.64
IGL02068:Pkhd1 APN 1 20,522,747 (GRCm38) missense probably damaging 1.00
IGL02083:Pkhd1 APN 1 20,201,227 (GRCm38) missense probably damaging 1.00
IGL02084:Pkhd1 APN 1 20,377,399 (GRCm38) missense probably damaging 1.00
IGL02126:Pkhd1 APN 1 20,117,195 (GRCm38) missense probably damaging 1.00
IGL02136:Pkhd1 APN 1 20,275,615 (GRCm38) missense probably damaging 1.00
IGL02255:Pkhd1 APN 1 20,584,101 (GRCm38) missense probably damaging 1.00
IGL02272:Pkhd1 APN 1 20,209,260 (GRCm38) missense probably damaging 1.00
IGL02308:Pkhd1 APN 1 20,070,376 (GRCm38) critical splice donor site probably null
IGL02364:Pkhd1 APN 1 20,200,783 (GRCm38) missense probably benign
IGL02389:Pkhd1 APN 1 20,117,720 (GRCm38) missense probably damaging 0.99
IGL02394:Pkhd1 APN 1 20,199,486 (GRCm38) missense possibly damaging 0.57
IGL02403:Pkhd1 APN 1 20,562,418 (GRCm38) missense probably benign 0.01
IGL02415:Pkhd1 APN 1 20,522,759 (GRCm38) missense probably damaging 1.00
IGL02415:Pkhd1 APN 1 20,414,421 (GRCm38) missense probably damaging 1.00
IGL02455:Pkhd1 APN 1 20,364,201 (GRCm38) missense probably damaging 1.00
IGL02502:Pkhd1 APN 1 20,392,165 (GRCm38) missense probably damaging 1.00
IGL02511:Pkhd1 APN 1 20,073,507 (GRCm38) missense possibly damaging 0.90
IGL02530:Pkhd1 APN 1 20,117,720 (GRCm38) missense probably damaging 0.99
IGL02532:Pkhd1 APN 1 20,117,720 (GRCm38) missense probably damaging 0.99
IGL02534:Pkhd1 APN 1 20,117,720 (GRCm38) missense probably damaging 0.99
IGL02556:Pkhd1 APN 1 20,310,710 (GRCm38) missense probably damaging 1.00
IGL02570:Pkhd1 APN 1 20,520,256 (GRCm38) missense probably damaging 0.99
IGL02605:Pkhd1 APN 1 20,550,902 (GRCm38) missense possibly damaging 0.66
IGL02641:Pkhd1 APN 1 20,558,752 (GRCm38) missense possibly damaging 0.61
IGL02741:Pkhd1 APN 1 20,220,029 (GRCm38) splice site probably benign
IGL02752:Pkhd1 APN 1 20,553,591 (GRCm38) missense possibly damaging 0.57
IGL02890:Pkhd1 APN 1 20,361,011 (GRCm38) missense probably damaging 1.00
IGL02959:Pkhd1 APN 1 20,608,416 (GRCm38) nonsense probably null
IGL02960:Pkhd1 APN 1 20,377,446 (GRCm38) missense possibly damaging 0.69
IGL02990:Pkhd1 APN 1 20,522,963 (GRCm38) missense possibly damaging 0.52
IGL03037:Pkhd1 APN 1 20,522,699 (GRCm38) missense probably benign 0.06
IGL03082:Pkhd1 APN 1 20,565,633 (GRCm38) missense probably damaging 1.00
IGL03114:Pkhd1 APN 1 20,198,171 (GRCm38) missense probably damaging 0.99
IGL03288:Pkhd1 APN 1 20,201,019 (GRCm38) missense probably benign 0.01
IGL03328:Pkhd1 APN 1 20,081,300 (GRCm38) splice site probably benign
IGL03375:Pkhd1 APN 1 20,117,023 (GRCm38) missense probably damaging 1.00
IGL03380:Pkhd1 APN 1 20,200,670 (GRCm38) missense probably damaging 1.00
IGL03046:Pkhd1 UTSW 1 20,537,365 (GRCm38) missense possibly damaging 0.81
LCD18:Pkhd1 UTSW 1 20,611,414 (GRCm38) intron probably benign
P0035:Pkhd1 UTSW 1 20,117,347 (GRCm38) missense probably benign 0.00
PIT4260001:Pkhd1 UTSW 1 20,222,906 (GRCm38) missense possibly damaging 0.51
R0063:Pkhd1 UTSW 1 20,211,950 (GRCm38) missense probably benign 0.02
R0063:Pkhd1 UTSW 1 20,211,950 (GRCm38) missense probably benign 0.02
R0071:Pkhd1 UTSW 1 20,201,344 (GRCm38) missense probably benign 0.11
R0071:Pkhd1 UTSW 1 20,201,344 (GRCm38) missense probably benign 0.11
R0094:Pkhd1 UTSW 1 20,209,246 (GRCm38) missense probably damaging 1.00
R0094:Pkhd1 UTSW 1 20,209,246 (GRCm38) missense probably damaging 1.00
R0103:Pkhd1 UTSW 1 20,523,359 (GRCm38) missense probably benign 0.04
R0103:Pkhd1 UTSW 1 20,523,359 (GRCm38) missense probably benign 0.04
R0105:Pkhd1 UTSW 1 20,523,732 (GRCm38) nonsense probably null
R0105:Pkhd1 UTSW 1 20,523,732 (GRCm38) nonsense probably null
R0115:Pkhd1 UTSW 1 20,350,490 (GRCm38) missense probably damaging 1.00
R0193:Pkhd1 UTSW 1 20,358,917 (GRCm38) missense probably damaging 1.00
R0245:Pkhd1 UTSW 1 20,540,400 (GRCm38) missense probably benign 0.03
R0277:Pkhd1 UTSW 1 20,275,538 (GRCm38) missense probably benign 0.04
R0310:Pkhd1 UTSW 1 20,549,822 (GRCm38) splice site probably null
R0323:Pkhd1 UTSW 1 20,275,538 (GRCm38) missense probably benign 0.04
R0395:Pkhd1 UTSW 1 20,381,547 (GRCm38) missense probably benign 0.26
R0412:Pkhd1 UTSW 1 20,117,788 (GRCm38) missense probably damaging 1.00
R0506:Pkhd1 UTSW 1 20,559,469 (GRCm38) missense probably benign 0.00
R0512:Pkhd1 UTSW 1 20,310,514 (GRCm38) splice site probably benign
R0550:Pkhd1 UTSW 1 20,347,223 (GRCm38) missense probably null 1.00
R0584:Pkhd1 UTSW 1 20,239,436 (GRCm38) nonsense probably null
R0586:Pkhd1 UTSW 1 20,524,111 (GRCm38) missense probably benign 0.04
R0598:Pkhd1 UTSW 1 20,200,890 (GRCm38) missense probably damaging 1.00
R0603:Pkhd1 UTSW 1 20,117,173 (GRCm38) missense probably benign 0.05
R0634:Pkhd1 UTSW 1 20,117,474 (GRCm38) missense probably damaging 1.00
R0677:Pkhd1 UTSW 1 20,524,230 (GRCm38) missense probably benign 0.01
R0746:Pkhd1 UTSW 1 20,198,107 (GRCm38) missense probably damaging 1.00
R0781:Pkhd1 UTSW 1 20,117,484 (GRCm38) missense probably benign 0.01
R0840:Pkhd1 UTSW 1 20,350,521 (GRCm38) missense probably damaging 0.98
R0946:Pkhd1 UTSW 1 20,199,381 (GRCm38) missense probably benign 0.10
R1018:Pkhd1 UTSW 1 20,201,259 (GRCm38) missense possibly damaging 0.89
R1028:Pkhd1 UTSW 1 20,117,726 (GRCm38) missense probably damaging 1.00
R1136:Pkhd1 UTSW 1 20,522,829 (GRCm38) missense possibly damaging 0.68
R1178:Pkhd1 UTSW 1 20,585,157 (GRCm38) critical splice donor site probably null
R1180:Pkhd1 UTSW 1 20,585,157 (GRCm38) critical splice donor site probably null
R1222:Pkhd1 UTSW 1 20,567,456 (GRCm38) missense probably benign 0.07
R1334:Pkhd1 UTSW 1 20,533,905 (GRCm38) missense possibly damaging 0.81
R1335:Pkhd1 UTSW 1 20,571,405 (GRCm38) missense probably damaging 1.00
R1387:Pkhd1 UTSW 1 20,555,223 (GRCm38) splice site probably benign
R1411:Pkhd1 UTSW 1 20,373,896 (GRCm38) missense probably damaging 1.00
R1443:Pkhd1 UTSW 1 20,534,558 (GRCm38) missense probably damaging 1.00
R1448:Pkhd1 UTSW 1 20,585,157 (GRCm38) critical splice donor site probably null
R1468:Pkhd1 UTSW 1 20,523,341 (GRCm38) missense probably damaging 1.00
R1468:Pkhd1 UTSW 1 20,523,341 (GRCm38) missense probably damaging 1.00
R1473:Pkhd1 UTSW 1 20,522,983 (GRCm38) missense probably benign 0.00
R1524:Pkhd1 UTSW 1 20,117,780 (GRCm38) missense probably damaging 1.00
R1532:Pkhd1 UTSW 1 20,117,401 (GRCm38) missense probably benign 0.08
R1565:Pkhd1 UTSW 1 20,347,457 (GRCm38) missense probably damaging 1.00
R1572:Pkhd1 UTSW 1 20,347,440 (GRCm38) missense probably benign 0.02
R1583:Pkhd1 UTSW 1 20,117,825 (GRCm38) missense probably benign
R1617:Pkhd1 UTSW 1 20,198,050 (GRCm38) missense possibly damaging 0.95
R1631:Pkhd1 UTSW 1 20,522,897 (GRCm38) missense probably benign 0.06
R1655:Pkhd1 UTSW 1 20,584,129 (GRCm38) missense probably damaging 1.00
R1707:Pkhd1 UTSW 1 20,550,840 (GRCm38) splice site probably benign
R1753:Pkhd1 UTSW 1 20,533,905 (GRCm38) missense possibly damaging 0.81
R1782:Pkhd1 UTSW 1 20,565,711 (GRCm38) missense probably damaging 0.98
R1791:Pkhd1 UTSW 1 20,585,152 (GRCm38) splice site probably benign
R1822:Pkhd1 UTSW 1 20,347,457 (GRCm38) missense probably damaging 1.00
R1823:Pkhd1 UTSW 1 20,347,457 (GRCm38) missense probably damaging 1.00
R1824:Pkhd1 UTSW 1 20,347,457 (GRCm38) missense probably damaging 1.00
R1836:Pkhd1 UTSW 1 20,117,069 (GRCm38) missense probably benign 0.01
R1862:Pkhd1 UTSW 1 20,551,020 (GRCm38) missense probably benign 0.00
R1863:Pkhd1 UTSW 1 20,551,020 (GRCm38) missense probably benign 0.00
R1869:Pkhd1 UTSW 1 20,615,267 (GRCm38) critical splice donor site probably null
R1913:Pkhd1 UTSW 1 20,566,756 (GRCm38) critical splice donor site probably null
R1928:Pkhd1 UTSW 1 20,081,300 (GRCm38) splice site probably benign
R1969:Pkhd1 UTSW 1 20,381,523 (GRCm38) missense probably damaging 1.00
R1970:Pkhd1 UTSW 1 20,381,523 (GRCm38) missense probably damaging 1.00
R1981:Pkhd1 UTSW 1 20,117,060 (GRCm38) missense probably benign 0.00
R2008:Pkhd1 UTSW 1 20,199,459 (GRCm38) missense probably damaging 0.99
R2034:Pkhd1 UTSW 1 20,200,669 (GRCm38) missense probably damaging 1.00
R2061:Pkhd1 UTSW 1 20,612,812 (GRCm38) missense possibly damaging 0.76
R2062:Pkhd1 UTSW 1 20,201,335 (GRCm38) missense probably damaging 0.97
R2108:Pkhd1 UTSW 1 20,553,574 (GRCm38) nonsense probably null
R2142:Pkhd1 UTSW 1 20,523,895 (GRCm38) missense probably benign 0.00
R2148:Pkhd1 UTSW 1 20,414,220 (GRCm38) critical splice donor site probably null
R2176:Pkhd1 UTSW 1 20,553,517 (GRCm38) missense probably damaging 1.00
R2202:Pkhd1 UTSW 1 20,537,360 (GRCm38) missense probably benign 0.06
R2255:Pkhd1 UTSW 1 20,565,639 (GRCm38) missense probably benign 0.23
R2269:Pkhd1 UTSW 1 20,534,535 (GRCm38) critical splice donor site probably null
R2275:Pkhd1 UTSW 1 20,200,849 (GRCm38) missense possibly damaging 0.95
R2340:Pkhd1 UTSW 1 20,200,855 (GRCm38) missense probably damaging 1.00
R2431:Pkhd1 UTSW 1 20,201,165 (GRCm38) missense possibly damaging 0.63
R2679:Pkhd1 UTSW 1 20,209,182 (GRCm38) missense probably benign 0.03
R2850:Pkhd1 UTSW 1 20,509,076 (GRCm38) missense possibly damaging 0.89
R2851:Pkhd1 UTSW 1 20,058,302 (GRCm38) missense probably benign 0.16
R2853:Pkhd1 UTSW 1 20,058,302 (GRCm38) missense probably benign 0.16
R2984:Pkhd1 UTSW 1 20,222,961 (GRCm38) missense possibly damaging 0.84
R2987:Pkhd1 UTSW 1 20,104,599 (GRCm38) missense possibly damaging 0.87
R3692:Pkhd1 UTSW 1 20,555,129 (GRCm38) missense possibly damaging 0.87
R3721:Pkhd1 UTSW 1 20,585,655 (GRCm38) missense probably benign 0.08
R3746:Pkhd1 UTSW 1 20,058,300 (GRCm38) makesense probably null
R3838:Pkhd1 UTSW 1 20,534,629 (GRCm38) missense possibly damaging 0.66
R3843:Pkhd1 UTSW 1 20,558,723 (GRCm38) missense probably benign 0.00
R3861:Pkhd1 UTSW 1 20,200,927 (GRCm38) missense probably damaging 1.00
R3893:Pkhd1 UTSW 1 20,312,138 (GRCm38) nonsense probably null
R3926:Pkhd1 UTSW 1 20,550,873 (GRCm38) missense probably benign 0.00
R4183:Pkhd1 UTSW 1 20,117,807 (GRCm38) missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20,563,686 (GRCm38) missense probably benign 0.06
R4184:Pkhd1 UTSW 1 20,209,277 (GRCm38) missense probably benign 0.03
R4255:Pkhd1 UTSW 1 20,593,934 (GRCm38) missense probably damaging 0.99
R4275:Pkhd1 UTSW 1 20,058,384 (GRCm38) missense probably benign 0.00
R4342:Pkhd1 UTSW 1 20,058,617 (GRCm38) missense probably benign 0.00
R4386:Pkhd1 UTSW 1 20,414,292 (GRCm38) missense probably benign 0.00
R4402:Pkhd1 UTSW 1 20,239,411 (GRCm38) missense probably damaging 1.00
R4431:Pkhd1 UTSW 1 20,523,314 (GRCm38) missense probably damaging 0.99
R4560:Pkhd1 UTSW 1 20,211,858 (GRCm38) missense probably damaging 1.00
R4561:Pkhd1 UTSW 1 20,534,719 (GRCm38) missense possibly damaging 0.89
R4570:Pkhd1 UTSW 1 20,381,523 (GRCm38) missense probably damaging 1.00
R4571:Pkhd1 UTSW 1 20,613,409 (GRCm38) missense probably damaging 1.00
R4588:Pkhd1 UTSW 1 20,200,868 (GRCm38) missense probably benign 0.00
R4598:Pkhd1 UTSW 1 20,503,056 (GRCm38) missense probably damaging 1.00
R4651:Pkhd1 UTSW 1 20,381,523 (GRCm38) missense probably damaging 1.00
R4657:Pkhd1 UTSW 1 20,364,167 (GRCm38) missense possibly damaging 0.89
R4718:Pkhd1 UTSW 1 20,081,228 (GRCm38) missense probably damaging 1.00
R4740:Pkhd1 UTSW 1 20,524,130 (GRCm38) missense probably benign
R4750:Pkhd1 UTSW 1 20,524,112 (GRCm38) missense possibly damaging 0.57
R4816:Pkhd1 UTSW 1 20,199,415 (GRCm38) missense probably damaging 0.99
R4825:Pkhd1 UTSW 1 20,537,401 (GRCm38) missense probably damaging 0.96
R4885:Pkhd1 UTSW 1 20,070,488 (GRCm38) missense possibly damaging 0.55
R4907:Pkhd1 UTSW 1 20,209,226 (GRCm38) missense probably damaging 1.00
R4944:Pkhd1 UTSW 1 20,288,205 (GRCm38) missense probably null 0.01
R5062:Pkhd1 UTSW 1 20,585,711 (GRCm38) missense probably benign 0.00
R5090:Pkhd1 UTSW 1 20,200,757 (GRCm38) missense probably damaging 1.00
R5104:Pkhd1 UTSW 1 20,585,191 (GRCm38) missense probably damaging 1.00
R5187:Pkhd1 UTSW 1 20,209,224 (GRCm38) missense possibly damaging 0.67
R5202:Pkhd1 UTSW 1 20,547,341 (GRCm38) missense probably benign 0.01
R5240:Pkhd1 UTSW 1 20,275,641 (GRCm38) missense probably benign 0.04
R5248:Pkhd1 UTSW 1 20,534,545 (GRCm38) missense probably benign 0.00
R5252:Pkhd1 UTSW 1 20,350,411 (GRCm38) critical splice donor site probably null
R5293:Pkhd1 UTSW 1 20,509,076 (GRCm38) missense possibly damaging 0.89
R5311:Pkhd1 UTSW 1 20,565,870 (GRCm38) missense possibly damaging 0.94
R5317:Pkhd1 UTSW 1 20,450,304 (GRCm38) missense probably damaging 1.00
R5346:Pkhd1 UTSW 1 20,523,434 (GRCm38) missense probably damaging 0.96
R5346:Pkhd1 UTSW 1 20,392,097 (GRCm38) missense probably benign
R5431:Pkhd1 UTSW 1 20,117,836 (GRCm38) missense probably benign 0.25
R5447:Pkhd1 UTSW 1 20,239,385 (GRCm38) missense probably benign 0.00
R5478:Pkhd1 UTSW 1 20,201,156 (GRCm38) missense probably damaging 1.00
R5497:Pkhd1 UTSW 1 20,377,404 (GRCm38) missense possibly damaging 0.94
R5554:Pkhd1 UTSW 1 20,081,252 (GRCm38) missense probably damaging 0.99
R5579:Pkhd1 UTSW 1 20,523,142 (GRCm38) missense probably damaging 0.96
R5614:Pkhd1 UTSW 1 20,073,526 (GRCm38) missense possibly damaging 0.83
R5648:Pkhd1 UTSW 1 20,558,626 (GRCm38) missense probably benign 0.04
R5651:Pkhd1 UTSW 1 20,117,807 (GRCm38) missense probably benign 0.03
R5665:Pkhd1 UTSW 1 20,588,531 (GRCm38) missense probably damaging 1.00
R5681:Pkhd1 UTSW 1 20,547,461 (GRCm38) missense possibly damaging 0.61
R5754:Pkhd1 UTSW 1 20,523,651 (GRCm38) nonsense probably null
R5760:Pkhd1 UTSW 1 20,073,554 (GRCm38) missense probably benign 0.02
R5776:Pkhd1 UTSW 1 20,209,185 (GRCm38) missense possibly damaging 0.62
R5782:Pkhd1 UTSW 1 20,058,600 (GRCm38) missense probably benign
R5810:Pkhd1 UTSW 1 20,200,673 (GRCm38) missense probably benign 0.26
R5814:Pkhd1 UTSW 1 20,199,405 (GRCm38) missense probably damaging 1.00
R5816:Pkhd1 UTSW 1 20,058,678 (GRCm38) missense probably benign 0.03
R5835:Pkhd1 UTSW 1 20,201,083 (GRCm38) missense probably benign 0.01
R5844:Pkhd1 UTSW 1 20,381,461 (GRCm38) missense probably benign 0.00
R5847:Pkhd1 UTSW 1 20,374,736 (GRCm38) nonsense probably null
R5852:Pkhd1 UTSW 1 20,377,408 (GRCm38) missense probably benign 0.22
R5863:Pkhd1 UTSW 1 20,520,210 (GRCm38) missense possibly damaging 0.63
R6213:Pkhd1 UTSW 1 20,523,770 (GRCm38) missense possibly damaging 0.80
R6351:Pkhd1 UTSW 1 20,211,951 (GRCm38) missense probably benign 0.00
R6386:Pkhd1 UTSW 1 20,551,020 (GRCm38) missense probably damaging 0.96
R6542:Pkhd1 UTSW 1 20,585,703 (GRCm38) missense probably benign 0.02
R6579:Pkhd1 UTSW 1 20,200,823 (GRCm38) missense probably benign 0.01
R6658:Pkhd1 UTSW 1 20,612,705 (GRCm38) missense probably damaging 1.00
R6765:Pkhd1 UTSW 1 20,058,339 (GRCm38) missense probably benign
R6886:Pkhd1 UTSW 1 20,347,280 (GRCm38) missense probably benign 0.01
R6892:Pkhd1 UTSW 1 20,523,515 (GRCm38) missense probably damaging 1.00
R6900:Pkhd1 UTSW 1 20,534,701 (GRCm38) missense probably benign 0.06
R6932:Pkhd1 UTSW 1 20,562,451 (GRCm38) missense probably benign 0.19
R7191:Pkhd1 UTSW 1 20,558,719 (GRCm38) missense probably benign 0.00
R7220:Pkhd1 UTSW 1 20,523,126 (GRCm38) missense possibly damaging 0.89
R7329:Pkhd1 UTSW 1 20,547,519 (GRCm38) missense probably damaging 0.96
R7361:Pkhd1 UTSW 1 20,593,953 (GRCm38) missense probably damaging 1.00
R7381:Pkhd1 UTSW 1 20,200,973 (GRCm38) missense probably damaging 1.00
R7388:Pkhd1 UTSW 1 20,239,304 (GRCm38) missense not run
R7436:Pkhd1 UTSW 1 20,200,701 (GRCm38) missense probably benign
R7473:Pkhd1 UTSW 1 20,549,756 (GRCm38) missense probably damaging 0.99
R7578:Pkhd1 UTSW 1 20,347,361 (GRCm38) missense probably damaging 1.00
R7751:Pkhd1 UTSW 1 20,200,925 (GRCm38) missense probably damaging 1.00
R7755:Pkhd1 UTSW 1 20,547,493 (GRCm38) missense probably damaging 0.98
R7757:Pkhd1 UTSW 1 20,562,415 (GRCm38) missense probably damaging 1.00
R7832:Pkhd1 UTSW 1 20,502,999 (GRCm38) missense probably damaging 1.00
R7834:Pkhd1 UTSW 1 20,312,049 (GRCm38) missense probably benign
R7920:Pkhd1 UTSW 1 20,275,535 (GRCm38) missense probably damaging 1.00
R8014:Pkhd1 UTSW 1 20,508,891 (GRCm38) critical splice donor site probably null
R8034:Pkhd1 UTSW 1 20,381,438 (GRCm38) missense possibly damaging 0.94
R8085:Pkhd1 UTSW 1 20,613,415 (GRCm38) missense probably damaging 1.00
R8087:Pkhd1 UTSW 1 20,523,089 (GRCm38) missense probably damaging 1.00
R8103:Pkhd1 UTSW 1 20,200,757 (GRCm38) missense probably damaging 1.00
R8122:Pkhd1 UTSW 1 20,562,458 (GRCm38) missense probably damaging 1.00
R8273:Pkhd1 UTSW 1 20,537,420 (GRCm38) splice site probably benign
R8485:Pkhd1 UTSW 1 20,523,033 (GRCm38) missense probably damaging 1.00
R8504:Pkhd1 UTSW 1 20,520,208 (GRCm38) missense probably benign 0.10
R8544:Pkhd1 UTSW 1 20,522,975 (GRCm38) missense probably damaging 1.00
R8692:Pkhd1 UTSW 1 20,392,150 (GRCm38) missense probably damaging 1.00
R8787:Pkhd1 UTSW 1 20,288,237 (GRCm38) missense probably damaging 0.99
R8853:Pkhd1 UTSW 1 20,073,455 (GRCm38) critical splice donor site probably null
R8907:Pkhd1 UTSW 1 20,117,561 (GRCm38) missense possibly damaging 0.88
R8934:Pkhd1 UTSW 1 20,392,010 (GRCm38) critical splice donor site probably null
R8990:Pkhd1 UTSW 1 20,347,305 (GRCm38) missense probably benign 0.00
R8998:Pkhd1 UTSW 1 20,364,201 (GRCm38) missense probably damaging 1.00
R9024:Pkhd1 UTSW 1 20,522,751 (GRCm38) missense probably benign 0.24
R9035:Pkhd1 UTSW 1 20,502,952 (GRCm38) missense probably damaging 1.00
R9092:Pkhd1 UTSW 1 20,562,362 (GRCm38) missense probably benign 0.00
R9238:Pkhd1 UTSW 1 20,534,575 (GRCm38) missense possibly damaging 0.89
R9258:Pkhd1 UTSW 1 20,373,950 (GRCm38) missense probably damaging 0.99
R9262:Pkhd1 UTSW 1 20,548,127 (GRCm38) missense probably benign 0.01
R9297:Pkhd1 UTSW 1 20,222,894 (GRCm38) missense probably benign 0.06
R9452:Pkhd1 UTSW 1 20,612,729 (GRCm38) missense possibly damaging 0.77
R9515:Pkhd1 UTSW 1 20,567,517 (GRCm38) missense probably damaging 1.00
R9540:Pkhd1 UTSW 1 20,199,346 (GRCm38) missense probably benign 0.00
R9542:Pkhd1 UTSW 1 20,117,780 (GRCm38) missense probably damaging 1.00
R9629:Pkhd1 UTSW 1 20,392,213 (GRCm38) missense possibly damaging 0.63
R9644:Pkhd1 UTSW 1 20,547,466 (GRCm38) missense probably benign 0.04
R9739:Pkhd1 UTSW 1 20,350,484 (GRCm38) missense probably damaging 1.00
R9767:Pkhd1 UTSW 1 20,414,412 (GRCm38) missense probably benign
R9781:Pkhd1 UTSW 1 20,117,441 (GRCm38) missense possibly damaging 0.95
R9803:Pkhd1 UTSW 1 20,566,849 (GRCm38) missense probably damaging 1.00
X0012:Pkhd1 UTSW 1 20,373,926 (GRCm38) missense probably damaging 1.00
X0067:Pkhd1 UTSW 1 20,520,226 (GRCm38) missense probably damaging 1.00
Z1176:Pkhd1 UTSW 1 20,523,747 (GRCm38) missense possibly damaging 0.81
Z1177:Pkhd1 UTSW 1 20,523,621 (GRCm38) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,310,594 (GRCm38) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,117,883 (GRCm38) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,551,019 (GRCm38) missense probably benign
Z1177:Pkhd1 UTSW 1 20,523,938 (GRCm38) missense probably damaging 1.00
Nature of Mutation
DNA sequencing using the SOLiD technique identified a T to G transversion at position 5223 of the Pkhd1 transcript, in exon 32 of 67 total exons (Figure 1). Multiple isoforms of Pkhd1 are found on Ensembl.   
 
5207 TCACGGAGCCAAGACATCTTAACCTTTACAGTG
1660 -S--R--S--Q--D--I--L--T--F--T--V-
 
The mutated nucleotide is indicated in red lettering, and causes an isoleucine to serine substitution at amino acid 1665 of the encoded protein. The mutation has been confirmed by DNA sequencing using the Sanger method (Figure 2).
Protein Function and Prediction
Pkhd1 encodes a 4060 amino acid protein known as polyductin or fibrocystin. Fibrocystin is a receptor-like protein thought to be involved in the tubulogenesis and maintenance of duct-lumen architecture of the epithelial layer of various organs. Mutations in the human and mouse genes encoding fibrocystin cause polycystic kidney disease, with the formation of cysts in many organs (OMIM #263200). Mouse fibrocystin is predicted to have an N-terminal signal peptide, multiple immunoglobulin-like plexin-transcription factor (IPT) domains, multiple parallel beta-helix 1 (PbH1) repeats, a single transmembrane-spanning domain and a short cytoplasmic C-terminus. Many additional isoforms, including secreted forms, are expressed in human and mouse tissues. 
 
The I1665S alteration does not occur in any known domains, but is predicted to be possibly damaging by the PolyPhen program.
Posted On 2009-11-06