Mutagenetix > Incidental Mutations

Incidental Mutation 'R2108:Pkhd1'

232218

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1

Ensembl Gene

ENSMUSG00000043760

Gene Name

polycystic kidney and hepatic disease 1

Synonyms

FPC, tigmin

MMRRC Submission

040112-MU

Accession Numbers

Genbank: NM_153179; MGI: 2155808

Is this an essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R2108 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20057779-20618064 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 20553574 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 766 (G766*)

Ref Sequence

ENSEMBL: ENSMUSP00000085794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088448]

Predicted Effect

probably null
Transcript: ENSMUST00000088448
AA Change: G766*

SMART Domains

Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: G766*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Blast:IPT	134	254	1e-45	BLAST
IPT	256	353	1.13e-3	SMART
low complexity region	722	743	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC
Pfam:TIG	936	1005	9.1e-8	PFAM
IPT	1016	1101	1.18e-6	SMART
IPT	1105	1190	1.27e0	SMART
IPT	1193	1290	7.05e-5	SMART
IPT	1384	1467	1.36e1	SMART
IPT	1568	1655	2.4e0	SMART
low complexity region	1881	1892	N/A	INTRINSIC
G8	1928	2049	1.15e-48	SMART
low complexity region	2079	2094	N/A	INTRINSIC
PbH1	2244	2266	7.82e3	SMART
PbH1	2287	2321	2.23e3	SMART
PbH1	2404	2426	7.19e2	SMART
PbH1	2459	2481	2.64e2	SMART
low complexity region	2713	2728	N/A	INTRINSIC
G8	2734	2867	1.73e-43	SMART
Blast:G8	2876	2923	2e-17	BLAST
PbH1	3004	3026	3.98e3	SMART
PbH1	3027	3049	1.27e0	SMART
PbH1	3080	3102	5.92e2	SMART
low complexity region	3178	3187	N/A	INTRINSIC
PbH1	3188	3212	8.08e3	SMART
transmembrane domain	3852	3874	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd10	A	G	16: 45,731,940	M190T	probably benign	Het
Abhd5	A	G	9: 122,377,940	Y250C	probably damaging	Het
Ace2	A	G	X: 164,140,732	N24S	probably benign	Het
Adamtsl2	A	G	2: 27,095,558	M485V	probably benign	Het
Adamtsl4	G	T	3: 95,681,047	P577H	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Apc	T	C	18: 34,269,229	Y141H	probably damaging	Het
Arsi	A	T	18: 60,916,371	T109S	possibly damaging	Het
Asb3	G	A	11: 31,081,355		probably null	Het
Atm	T	C	9: 53,443,997	D2899G	probably damaging	Het
Bcas3	G	A	11: 85,457,878	V199I	probably damaging	Het
Bub1	T	C	2: 127,819,335	K279E	probably damaging	Het
C3	A	T	17: 57,223,974		probably null	Het
Cabcoco1	T	C	10: 68,431,323	K185E	probably benign	Het
Cadm2	A	T	16: 66,731,471	I326N	probably benign	Het
Ccr3	T	C	9: 124,029,299	S224P	possibly damaging	Het
Cdhr4	A	G	9: 107,997,644	T638A	probably damaging	Het
Cfap46	T	C	7: 139,683,761	I4V	probably benign	Het
Csf2rb2	A	T	15: 78,292,544	V216E	probably damaging	Het
Csmd3	A	T	15: 48,004,861	D754E	possibly damaging	Het
Dnaaf1	T	C	8: 119,582,732		probably null	Het
Dnah11	A	C	12: 118,020,353	Y2466D	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
E2f7	T	C	10: 110,780,902	Y668H	probably benign	Het
Ehmt1	A	T	2: 24,837,618	S735T	probably damaging	Het
Eomes	T	C	9: 118,478,852	F65L	probably benign	Het
Ercc6l2	T	C	13: 63,871,988		probably benign	Het
Fbrsl1	A	T	5: 110,378,434	L439Q	probably damaging	Het
Fyco1	C	T	9: 123,797,516		probably null	Het
Gfm2	A	G	13: 97,155,442	T229A	probably benign	Het
Gm7735	G	A	16: 89,169,545	G19D	unknown	Het
Gm9745	G	A	13: 8,941,728	P221S	possibly damaging	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpr6	T	A	10: 41,070,653	Y311F	possibly damaging	Het
Gprc6a	A	T	10: 51,615,208	V744E	probably damaging	Het
Grin3a	C	T	4: 49,665,510	D1042N	possibly damaging	Het
Gstm3	A	G	3: 107,966,134	C174R	probably damaging	Het
Hectd4	A	G	5: 121,333,424	E2670G	possibly damaging	Het
Hsd3b6	A	T	3: 98,806,187	Y265*	probably null	Het
Hus1	T	A	11: 9,011,110	M1L	probably null	Het
Ifi213	T	G	1: 173,569,102		probably null	Het
Igf2r	A	C	17: 12,698,251	N1587K	probably benign	Het
Ints1	A	T	5: 139,767,750	V709E	probably damaging	Het
Ints8	C	A	4: 11,235,552	R359L	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrp1b	C	T	2: 41,110,757	E2152K	probably damaging	Het
Lrp2	A	T	2: 69,506,624	V1268D	possibly damaging	Het
Mpo	T	C	11: 87,796,075	Y177H	probably damaging	Het
Mpp4	G	A	1: 59,143,782	P322L	possibly damaging	Het
Mprip	A	G	11: 59,769,891	K2166R	probably damaging	Het
Myo15	T	C	11: 60,491,810	Y1544H	probably damaging	Het
Neu1	G	A	17: 34,934,398	R299Q	probably benign	Het
Nfxl1	C	A	5: 72,514,332		probably null	Het
Nrp2	T	A	1: 62,744,277	I179N	probably damaging	Het
Nup153	A	G	13: 46,693,510		probably null	Het
Olfr130	G	T	17: 38,067,855	R228L	possibly damaging	Het
Olfr350	C	A	2: 36,850,343	A99E	possibly damaging	Het
Olfr474	A	T	7: 107,955,502	H287L	probably benign	Het
Olfr804	A	T	10: 129,705,621	I248L	probably benign	Het
Olfr944	A	T	9: 39,218,022	I222F	probably damaging	Het
P2ry12	A	T	3: 59,217,353	D300E	probably damaging	Het
Plagl1	A	C	10: 13,128,647		probably benign	Het
Prkcq	A	T	2: 11,232,569	Y53F	probably damaging	Het
Psg18	T	C	7: 18,350,874	E99G	probably damaging	Het
Ptprz1	T	A	6: 23,033,477	H1921Q	probably damaging	Het
Rcc1l	A	G	5: 134,155,790	V391A	probably benign	Het
Sdr42e1	C	T	8: 117,665,024	V11I	probably damaging	Het
Slc12a3	C	A	8: 94,340,530	N404K	probably damaging	Het
Slc38a4	T	C	15: 97,008,997	M287V	probably benign	Het
Slc6a8	A	T	X: 73,676,886	I96F	possibly damaging	Het
Smyd2	A	G	1: 189,897,426	S136P	probably damaging	Het
Sox11	A	G	12: 27,341,703	Y236H	probably damaging	Het
Tbc1d2	G	A	4: 46,637,652	P198L	possibly damaging	Het
Tcof1	G	T	18: 60,835,773	A256E	probably damaging	Het
Tenm4	A	G	7: 96,906,290	Y2726C	probably damaging	Het
Tnfsf14	T	A	17: 57,190,867	R122W	probably damaging	Het
Tril	T	C	6: 53,819,083	T385A	probably damaging	Het
Trrap	A	G	5: 144,825,874	T2386A	probably benign	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Uba7	A	G	9: 107,979,288	M595V	probably benign	Het
Usp43	GC	G	11: 67,855,740		probably null	Het
Utrn	C	A	10: 12,436,364	D616Y	probably damaging	Het
Vmn2r69	T	C	7: 85,410,196	I502V	probably benign	Het
Vps13d	C	A	4: 145,075,047	G419C	probably damaging	Het
Zbtb25	A	T	12: 76,350,106	M114K	probably benign	Het
Zcchc4	A	G	5: 52,796,132	Y161C	probably damaging	Het
Zfp292	A	T	4: 34,808,593	F1484I	possibly damaging	Het
Zfp326	A	G	5: 105,914,780		probably benign	Het
Zfp395	T	A	14: 65,393,116	S372T	probably benign	Het
Zfp423	T	A	8: 87,781,178	E825V	possibly damaging	Het
Zfp445	A	T	9: 122,852,240	Y879N	probably benign	Het
Zfp451	A	G	1: 33,779,167	I77T	possibly damaging	Het
Zfp85	A	T	13: 67,748,884	S356R	probably benign	Het

Other mutations in Pkhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Pkhd1	APN	1	20566874	critical splice acceptor site	probably null
IGL00687:Pkhd1	APN	1	20524070	missense	probably benign	0.19
IGL00824:Pkhd1	APN	1	20081184	critical splice donor site	probably null
IGL00870:Pkhd1	APN	1	20571390	missense	probably damaging	1.00
IGL00911:Pkhd1	APN	1	20117747	missense	probably benign	0.00
IGL01015:Pkhd1	APN	1	20523258	missense	possibly damaging	0.95
IGL01025:Pkhd1	APN	1	20209176	missense	probably benign	0.04
IGL01064:Pkhd1	APN	1	20534530	splice site	probably benign
IGL01313:Pkhd1	APN	1	20201024	missense	probably damaging	1.00
IGL01340:Pkhd1	APN	1	20522977	missense	probably benign	0.01
IGL01352:Pkhd1	APN	1	20549715	missense	probably benign	0.34
IGL01456:Pkhd1	APN	1	20199459	missense	probably damaging	1.00
IGL01530:Pkhd1	APN	1	20559419	critical splice donor site	probably null
IGL01557:Pkhd1	APN	1	20116979	missense	possibly damaging	0.59
IGL01655:Pkhd1	APN	1	20534633	nonsense	probably null
IGL01790:Pkhd1	APN	1	20558671	missense	probably damaging	0.96
IGL01862:Pkhd1	APN	1	20358910	missense	probably damaging	1.00
IGL01874:Pkhd1	APN	1	20103235	missense	probably benign	0.32
IGL01901:Pkhd1	APN	1	20220083	missense	probably benign	0.11
IGL01903:Pkhd1	APN	1	20198137	missense	probably damaging	1.00
IGL01981:Pkhd1	APN	1	20523567	missense	possibly damaging	0.64
IGL02068:Pkhd1	APN	1	20522747	missense	probably damaging	1.00
IGL02083:Pkhd1	APN	1	20201227	missense	probably damaging	1.00
IGL02084:Pkhd1	APN	1	20377399	missense	probably damaging	1.00
IGL02126:Pkhd1	APN	1	20117195	missense	probably damaging	1.00
IGL02136:Pkhd1	APN	1	20275615	missense	probably damaging	1.00
IGL02255:Pkhd1	APN	1	20584101	missense	probably damaging	1.00
IGL02272:Pkhd1	APN	1	20209260	missense	probably damaging	1.00
IGL02308:Pkhd1	APN	1	20070376	critical splice donor site	probably null
IGL02364:Pkhd1	APN	1	20200783	missense	probably benign
IGL02389:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02394:Pkhd1	APN	1	20199486	missense	possibly damaging	0.57
IGL02403:Pkhd1	APN	1	20562418	missense	probably benign	0.01
IGL02415:Pkhd1	APN	1	20414421	missense	probably damaging	1.00
IGL02415:Pkhd1	APN	1	20522759	missense	probably damaging	1.00
IGL02455:Pkhd1	APN	1	20364201	missense	probably damaging	1.00
IGL02502:Pkhd1	APN	1	20392165	missense	probably damaging	1.00
IGL02511:Pkhd1	APN	1	20073507	missense	possibly damaging	0.90
IGL02530:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02532:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02534:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02556:Pkhd1	APN	1	20310710	missense	probably damaging	1.00
IGL02570:Pkhd1	APN	1	20520256	missense	probably damaging	0.99
IGL02605:Pkhd1	APN	1	20550902	missense	possibly damaging	0.66
IGL02641:Pkhd1	APN	1	20558752	missense	possibly damaging	0.61
IGL02741:Pkhd1	APN	1	20220029	splice site	probably benign
IGL02752:Pkhd1	APN	1	20553591	missense	possibly damaging	0.57
IGL02890:Pkhd1	APN	1	20361011	missense	probably damaging	1.00
IGL02959:Pkhd1	APN	1	20608416	nonsense	probably null
IGL02960:Pkhd1	APN	1	20377446	missense	possibly damaging	0.69
IGL02990:Pkhd1	APN	1	20522963	missense	possibly damaging	0.52
IGL03037:Pkhd1	APN	1	20522699	missense	probably benign	0.06
IGL03082:Pkhd1	APN	1	20565633	missense	probably damaging	1.00
IGL03114:Pkhd1	APN	1	20198171	missense	probably damaging	0.99
IGL03288:Pkhd1	APN	1	20201019	missense	probably benign	0.01
IGL03328:Pkhd1	APN	1	20081300	splice site	probably benign
IGL03375:Pkhd1	APN	1	20117023	missense	probably damaging	1.00
IGL03380:Pkhd1	APN	1	20200670	missense	probably damaging	1.00
0152:Pkhd1	UTSW	1	20522894	missense	possibly damaging	0.46
IGL03046:Pkhd1	UTSW	1	20537365	missense	possibly damaging	0.81
LCD18:Pkhd1	UTSW	1	20611414	intron	probably benign
P0035:Pkhd1	UTSW	1	20117347	missense	probably benign	0.00
PIT4260001:Pkhd1	UTSW	1	20222906	missense	possibly damaging	0.51
R0063:Pkhd1	UTSW	1	20211950	missense	probably benign	0.02
R0063:Pkhd1	UTSW	1	20211950	missense	probably benign	0.02
R0071:Pkhd1	UTSW	1	20201344	missense	probably benign	0.11
R0071:Pkhd1	UTSW	1	20201344	missense	probably benign	0.11
R0094:Pkhd1	UTSW	1	20209246	missense	probably damaging	1.00
R0094:Pkhd1	UTSW	1	20209246	missense	probably damaging	1.00
R0103:Pkhd1	UTSW	1	20523359	missense	probably benign	0.04
R0103:Pkhd1	UTSW	1	20523359	missense	probably benign	0.04
R0105:Pkhd1	UTSW	1	20523732	nonsense	probably null
R0105:Pkhd1	UTSW	1	20523732	nonsense	probably null
R0115:Pkhd1	UTSW	1	20350490	missense	probably damaging	1.00
R0193:Pkhd1	UTSW	1	20358917	missense	probably damaging	1.00
R0245:Pkhd1	UTSW	1	20540400	missense	probably benign	0.03
R0277:Pkhd1	UTSW	1	20275538	missense	probably benign	0.04
R0310:Pkhd1	UTSW	1	20549822	splice site	probably null
R0323:Pkhd1	UTSW	1	20275538	missense	probably benign	0.04
R0395:Pkhd1	UTSW	1	20381547	missense	probably benign	0.26
R0412:Pkhd1	UTSW	1	20117788	missense	probably damaging	1.00
R0506:Pkhd1	UTSW	1	20559469	missense	probably benign	0.00
R0512:Pkhd1	UTSW	1	20310514	splice site	probably benign
R0550:Pkhd1	UTSW	1	20347223	missense	probably null	1.00
R0584:Pkhd1	UTSW	1	20239436	nonsense	probably null
R0586:Pkhd1	UTSW	1	20524111	missense	probably benign	0.04
R0598:Pkhd1	UTSW	1	20200890	missense	probably damaging	1.00
R0603:Pkhd1	UTSW	1	20117173	missense	probably benign	0.05
R0634:Pkhd1	UTSW	1	20117474	missense	probably damaging	1.00
R0677:Pkhd1	UTSW	1	20524230	missense	probably benign	0.01
R0746:Pkhd1	UTSW	1	20198107	missense	probably damaging	1.00
R0781:Pkhd1	UTSW	1	20117484	missense	probably benign	0.01
R0840:Pkhd1	UTSW	1	20350521	missense	probably damaging	0.98
R0946:Pkhd1	UTSW	1	20199381	missense	probably benign	0.10
R1018:Pkhd1	UTSW	1	20201259	missense	possibly damaging	0.89
R1028:Pkhd1	UTSW	1	20117726	missense	probably damaging	1.00
R1136:Pkhd1	UTSW	1	20522829	missense	possibly damaging	0.68
R1178:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1180:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1222:Pkhd1	UTSW	1	20567456	missense	probably benign	0.07
R1334:Pkhd1	UTSW	1	20533905	missense	possibly damaging	0.81
R1335:Pkhd1	UTSW	1	20571405	missense	probably damaging	1.00
R1387:Pkhd1	UTSW	1	20555223	splice site	probably benign
R1411:Pkhd1	UTSW	1	20373896	missense	probably damaging	1.00
R1443:Pkhd1	UTSW	1	20534558	missense	probably damaging	1.00
R1448:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1468:Pkhd1	UTSW	1	20523341	missense	probably damaging	1.00
R1468:Pkhd1	UTSW	1	20523341	missense	probably damaging	1.00
R1473:Pkhd1	UTSW	1	20522983	missense	probably benign	0.00
R1524:Pkhd1	UTSW	1	20117780	missense	probably damaging	1.00
R1532:Pkhd1	UTSW	1	20117401	missense	probably benign	0.08
R1565:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1572:Pkhd1	UTSW	1	20347440	missense	probably benign	0.02
R1583:Pkhd1	UTSW	1	20117825	missense	probably benign
R1617:Pkhd1	UTSW	1	20198050	missense	possibly damaging	0.95
R1631:Pkhd1	UTSW	1	20522897	missense	probably benign	0.06
R1655:Pkhd1	UTSW	1	20584129	missense	probably damaging	1.00
R1707:Pkhd1	UTSW	1	20550840	splice site	probably benign
R1753:Pkhd1	UTSW	1	20533905	missense	possibly damaging	0.81
R1782:Pkhd1	UTSW	1	20565711	missense	probably damaging	0.98
R1791:Pkhd1	UTSW	1	20585152	splice site	probably benign
R1822:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1823:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1824:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1836:Pkhd1	UTSW	1	20117069	missense	probably benign	0.01
R1862:Pkhd1	UTSW	1	20551020	missense	probably benign	0.00
R1863:Pkhd1	UTSW	1	20551020	missense	probably benign	0.00
R1869:Pkhd1	UTSW	1	20615267	critical splice donor site	probably null
R1913:Pkhd1	UTSW	1	20566756	critical splice donor site	probably null
R1928:Pkhd1	UTSW	1	20081300	splice site	probably benign
R1969:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R1970:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R1981:Pkhd1	UTSW	1	20117060	missense	probably benign	0.00
R2008:Pkhd1	UTSW	1	20199459	missense	probably damaging	0.99
R2034:Pkhd1	UTSW	1	20200669	missense	probably damaging	1.00
R2061:Pkhd1	UTSW	1	20612812	missense	possibly damaging	0.76
R2062:Pkhd1	UTSW	1	20201335	missense	probably damaging	0.97
R2142:Pkhd1	UTSW	1	20523895	missense	probably benign	0.00
R2148:Pkhd1	UTSW	1	20414220	critical splice donor site	probably null
R2176:Pkhd1	UTSW	1	20553517	missense	probably damaging	1.00
R2202:Pkhd1	UTSW	1	20537360	missense	probably benign	0.06
R2255:Pkhd1	UTSW	1	20565639	missense	probably benign	0.23
R2269:Pkhd1	UTSW	1	20534535	critical splice donor site	probably null
R2275:Pkhd1	UTSW	1	20200849	missense	possibly damaging	0.95
R2340:Pkhd1	UTSW	1	20200855	missense	probably damaging	1.00
R2431:Pkhd1	UTSW	1	20201165	missense	possibly damaging	0.63
R2679:Pkhd1	UTSW	1	20209182	missense	probably benign	0.03
R2850:Pkhd1	UTSW	1	20509076	missense	possibly damaging	0.89
R2851:Pkhd1	UTSW	1	20058302	missense	probably benign	0.16
R2853:Pkhd1	UTSW	1	20058302	missense	probably benign	0.16
R2984:Pkhd1	UTSW	1	20222961	missense	possibly damaging	0.84
R2987:Pkhd1	UTSW	1	20104599	missense	possibly damaging	0.87
R3692:Pkhd1	UTSW	1	20555129	missense	possibly damaging	0.87
R3721:Pkhd1	UTSW	1	20585655	missense	probably benign	0.08
R3746:Pkhd1	UTSW	1	20058300	makesense	probably null
R3838:Pkhd1	UTSW	1	20534629	missense	possibly damaging	0.66
R3843:Pkhd1	UTSW	1	20558723	missense	probably benign	0.00
R3861:Pkhd1	UTSW	1	20200927	missense	probably damaging	1.00
R3893:Pkhd1	UTSW	1	20312138	nonsense	probably null
R3926:Pkhd1	UTSW	1	20550873	missense	probably benign	0.00
R4183:Pkhd1	UTSW	1	20117807	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20209277	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20563686	missense	probably benign	0.06
R4255:Pkhd1	UTSW	1	20593934	missense	probably damaging	0.99
R4275:Pkhd1	UTSW	1	20058384	missense	probably benign	0.00
R4342:Pkhd1	UTSW	1	20058617	missense	probably benign	0.00
R4386:Pkhd1	UTSW	1	20414292	missense	probably benign	0.00
R4402:Pkhd1	UTSW	1	20239411	missense	probably damaging	1.00
R4431:Pkhd1	UTSW	1	20523314	missense	probably damaging	0.99
R4560:Pkhd1	UTSW	1	20211858	missense	probably damaging	1.00
R4561:Pkhd1	UTSW	1	20534719	missense	possibly damaging	0.89
R4570:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R4571:Pkhd1	UTSW	1	20613409	missense	probably damaging	1.00
R4588:Pkhd1	UTSW	1	20200868	missense	probably benign	0.00
R4598:Pkhd1	UTSW	1	20503056	missense	probably damaging	1.00
R4651:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R4657:Pkhd1	UTSW	1	20364167	missense	possibly damaging	0.89
R4718:Pkhd1	UTSW	1	20081228	missense	probably damaging	1.00
R4740:Pkhd1	UTSW	1	20524130	missense	probably benign
R4750:Pkhd1	UTSW	1	20524112	missense	possibly damaging	0.57
R4816:Pkhd1	UTSW	1	20199415	missense	probably damaging	0.99
R4825:Pkhd1	UTSW	1	20537401	missense	probably damaging	0.96
R4885:Pkhd1	UTSW	1	20070488	missense	possibly damaging	0.55
R4907:Pkhd1	UTSW	1	20209226	missense	probably damaging	1.00
R4944:Pkhd1	UTSW	1	20288205	missense	probably null	0.01
R5062:Pkhd1	UTSW	1	20585711	missense	probably benign	0.00
R5090:Pkhd1	UTSW	1	20200757	missense	probably damaging	1.00
R5104:Pkhd1	UTSW	1	20585191	missense	probably damaging	1.00
R5187:Pkhd1	UTSW	1	20209224	missense	possibly damaging	0.67
R5202:Pkhd1	UTSW	1	20547341	missense	probably benign	0.01
R5240:Pkhd1	UTSW	1	20275641	missense	probably benign	0.04
R5248:Pkhd1	UTSW	1	20534545	missense	probably benign	0.00
R5252:Pkhd1	UTSW	1	20350411	critical splice donor site	probably null
R5293:Pkhd1	UTSW	1	20509076	missense	possibly damaging	0.89
R5311:Pkhd1	UTSW	1	20565870	missense	possibly damaging	0.94
R5317:Pkhd1	UTSW	1	20450304	missense	probably damaging	1.00
R5346:Pkhd1	UTSW	1	20392097	missense	probably benign
R5346:Pkhd1	UTSW	1	20523434	missense	probably damaging	0.96
R5431:Pkhd1	UTSW	1	20117836	missense	probably benign	0.25
R5447:Pkhd1	UTSW	1	20239385	missense	probably benign	0.00
R5478:Pkhd1	UTSW	1	20201156	missense	probably damaging	1.00
R5497:Pkhd1	UTSW	1	20377404	missense	possibly damaging	0.94
R5554:Pkhd1	UTSW	1	20081252	missense	probably damaging	0.99
R5579:Pkhd1	UTSW	1	20523142	missense	probably damaging	0.96
R5614:Pkhd1	UTSW	1	20073526	missense	possibly damaging	0.83
R5648:Pkhd1	UTSW	1	20558626	missense	probably benign	0.04
R5651:Pkhd1	UTSW	1	20117807	missense	probably benign	0.03
R5665:Pkhd1	UTSW	1	20588531	missense	probably damaging	1.00
R5681:Pkhd1	UTSW	1	20547461	missense	possibly damaging	0.61
R5754:Pkhd1	UTSW	1	20523651	nonsense	probably null
R5760:Pkhd1	UTSW	1	20073554	missense	probably benign	0.02
R5776:Pkhd1	UTSW	1	20209185	missense	possibly damaging	0.62
R5782:Pkhd1	UTSW	1	20058600	missense	probably benign
R5810:Pkhd1	UTSW	1	20200673	missense	probably benign	0.26
R5814:Pkhd1	UTSW	1	20199405	missense	probably damaging	1.00
R5816:Pkhd1	UTSW	1	20058678	missense	probably benign	0.03
R5835:Pkhd1	UTSW	1	20201083	missense	probably benign	0.01
R5844:Pkhd1	UTSW	1	20381461	missense	probably benign	0.00
R5847:Pkhd1	UTSW	1	20374736	nonsense	probably null
R5852:Pkhd1	UTSW	1	20377408	missense	probably benign	0.22
R5863:Pkhd1	UTSW	1	20520210	missense	possibly damaging	0.63
R6213:Pkhd1	UTSW	1	20523770	missense	possibly damaging	0.80
R6351:Pkhd1	UTSW	1	20211951	missense	probably benign	0.00
R6386:Pkhd1	UTSW	1	20551020	missense	probably damaging	0.96
R6542:Pkhd1	UTSW	1	20585703	missense	probably benign	0.02
R6579:Pkhd1	UTSW	1	20200823	missense	probably benign	0.01
R6658:Pkhd1	UTSW	1	20612705	missense	probably damaging	1.00
R6765:Pkhd1	UTSW	1	20058339	missense	probably benign
R6886:Pkhd1	UTSW	1	20347280	missense	probably benign	0.01
R6892:Pkhd1	UTSW	1	20523515	missense	probably damaging	1.00
R6900:Pkhd1	UTSW	1	20534701	missense	probably benign	0.06
R6932:Pkhd1	UTSW	1	20562451	missense	probably benign	0.19
R7191:Pkhd1	UTSW	1	20558719	missense	probably benign	0.00
R7220:Pkhd1	UTSW	1	20523126	missense	possibly damaging	0.89
R7329:Pkhd1	UTSW	1	20547519	missense	probably damaging	0.96
R7361:Pkhd1	UTSW	1	20593953	missense	probably damaging	1.00
R7381:Pkhd1	UTSW	1	20200973	missense	probably damaging	1.00
R7388:Pkhd1	UTSW	1	20239304	missense	not run
R7436:Pkhd1	UTSW	1	20200701	missense	probably benign
R7473:Pkhd1	UTSW	1	20549756	missense	probably damaging	0.99
R7578:Pkhd1	UTSW	1	20347361	missense	probably damaging	1.00
R7751:Pkhd1	UTSW	1	20200925	missense	probably damaging	1.00
R7755:Pkhd1	UTSW	1	20547493	missense	probably damaging	0.98
R7757:Pkhd1	UTSW	1	20562415	missense	probably damaging	1.00
R7832:Pkhd1	UTSW	1	20502999	missense	probably damaging	1.00
R7834:Pkhd1	UTSW	1	20312049	missense	probably benign
R7920:Pkhd1	UTSW	1	20275535	missense	probably damaging	1.00
R8014:Pkhd1	UTSW	1	20508891	critical splice donor site	probably null
R8034:Pkhd1	UTSW	1	20381438	missense	possibly damaging	0.94
R8085:Pkhd1	UTSW	1	20613415	missense	probably damaging	1.00
R8087:Pkhd1	UTSW	1	20523089	missense	probably damaging	1.00
R8103:Pkhd1	UTSW	1	20200757	missense	probably damaging	1.00
R8122:Pkhd1	UTSW	1	20562458	missense	probably damaging	1.00
R8273:Pkhd1	UTSW	1	20537420	splice site	probably benign
R8504:Pkhd1	UTSW	1	20520208	missense	probably benign	0.10
X0012:Pkhd1	UTSW	1	20373926	missense	probably damaging	1.00
X0067:Pkhd1	UTSW	1	20520226	missense	probably damaging	1.00
Z1176:Pkhd1	UTSW	1	20523747	missense	possibly damaging	0.81
Z1177:Pkhd1	UTSW	1	20117883	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20310594	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20523621	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20523938	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20551019	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTCGCAGGCTATGTTTCCC -3'
(R):5'- TGCTGGTACACTTTTCAAAGGCC -3'

Sequencing Primer
(F):5'- CTTATGTGCCCCAGTATGTGCATG -3'
(R):5'- AGCACATTATTCCTGCTGTGATG -3'

Posted On

2014-09-18