Incidental Mutation 'R8907:Pkhd1'
ID 678413
Institutional Source Beutler Lab
Gene Symbol Pkhd1
Ensembl Gene ENSMUSG00000043760
Gene Name polycystic kidney and hepatic disease 1
Synonyms FPC, tigmin
MMRRC Submission 068763-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R8907 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 20128003-20688288 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20187785 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 3508 (I3508V)
Ref Sequence ENSEMBL: ENSMUSP00000085794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088448]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000088448
AA Change: I3508V

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: I3508V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IPT 134 254 1e-45 BLAST
IPT 256 353 1.13e-3 SMART
low complexity region 722 743 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Pfam:TIG 936 1005 9.1e-8 PFAM
IPT 1016 1101 1.18e-6 SMART
IPT 1105 1190 1.27e0 SMART
IPT 1193 1290 7.05e-5 SMART
IPT 1384 1467 1.36e1 SMART
IPT 1568 1655 2.4e0 SMART
low complexity region 1881 1892 N/A INTRINSIC
G8 1928 2049 1.15e-48 SMART
low complexity region 2079 2094 N/A INTRINSIC
PbH1 2244 2266 7.82e3 SMART
PbH1 2287 2321 2.23e3 SMART
PbH1 2404 2426 7.19e2 SMART
PbH1 2459 2481 2.64e2 SMART
low complexity region 2713 2728 N/A INTRINSIC
G8 2734 2867 1.73e-43 SMART
Blast:G8 2876 2923 2e-17 BLAST
PbH1 3004 3026 3.98e3 SMART
PbH1 3027 3049 1.27e0 SMART
PbH1 3080 3102 5.92e2 SMART
low complexity region 3178 3187 N/A INTRINSIC
PbH1 3188 3212 8.08e3 SMART
transmembrane domain 3852 3874 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik A G 8: 33,919,398 (GRCm39) I73V probably damaging Het
Agap3 T C 5: 24,679,629 (GRCm39) I109T probably benign Het
Ahnak G A 19: 8,986,452 (GRCm39) V2579M probably benign Het
Akap13 T C 7: 75,260,444 (GRCm39) S220P probably benign Het
Akap13 C G 7: 75,260,456 (GRCm39) P224A probably damaging Het
Alpk1 G A 3: 127,474,642 (GRCm39) Q454* probably null Het
Asrgl1 C T 19: 9,090,506 (GRCm39) G280D probably damaging Het
Atp6v0d1 TTCTTACCTC T 8: 106,251,782 (GRCm39) probably benign Het
Atxn2l T A 7: 126,099,425 (GRCm39) D204V probably damaging Het
B430306N03Rik T C 17: 48,628,100 (GRCm39) Y177H probably damaging Het
Bcl2l14 G A 6: 134,400,585 (GRCm39) C2Y probably damaging Het
Bltp1 T A 3: 37,002,295 (GRCm39) Y1413* probably null Het
Bphl A T 13: 34,230,930 (GRCm39) M125L possibly damaging Het
Cdh10 A T 15: 19,013,521 (GRCm39) N707I probably damaging Het
Ceacam1 T A 7: 25,171,444 (GRCm39) D340V possibly damaging Het
Cklf G A 8: 104,977,671 (GRCm39) V8I probably benign Het
Cln5 A G 14: 103,310,711 (GRCm39) N126S probably damaging Het
Col5a2 A T 1: 45,456,106 (GRCm39) M327K probably benign Het
Col6a6 A T 9: 105,644,528 (GRCm39) F1253L probably damaging Het
Crb2 G A 2: 37,685,395 (GRCm39) S1169N probably benign Het
Cspg4 A T 9: 56,790,967 (GRCm39) D72V probably damaging Het
Ctnnd2 C T 15: 30,905,873 (GRCm39) P840L probably damaging Het
Eea1 T C 10: 95,826,274 (GRCm39) Y105H probably damaging Het
Epha4 A C 1: 77,483,422 (GRCm39) S196A probably damaging Het
Evx1 C T 6: 52,293,746 (GRCm39) R305C probably damaging Het
Fcamr G T 1: 130,740,328 (GRCm39) G249V probably damaging Het
Fdxacb1 C T 9: 50,681,451 (GRCm39) T124I probably damaging Het
Fmn1 T G 2: 113,355,914 (GRCm39) L883R unknown Het
Frmd4b T C 6: 97,273,046 (GRCm39) N782S probably damaging Het
Frmpd2 T G 14: 33,248,380 (GRCm39) C621W probably damaging Het
Fsip2 T A 2: 82,816,984 (GRCm39) V4239D probably benign Het
Gcnt4 A G 13: 97,083,844 (GRCm39) Y380C probably damaging Het
Gm7298 T C 6: 121,741,817 (GRCm39) V413A probably benign Het
Gstp3 C T 19: 4,108,145 (GRCm39) V93M possibly damaging Het
Helz2 A T 2: 180,874,920 (GRCm39) M1858K possibly damaging Het
Ighv1-7 T A 12: 114,502,353 (GRCm39) K38M probably damaging Het
Klri1 T C 6: 129,680,283 (GRCm39) K124R probably null Het
Kmt2c A T 5: 25,514,609 (GRCm39) F3078Y probably damaging Het
Map4k4 C T 1: 40,058,770 (GRCm39) P988L probably damaging Het
Mmrn1 G A 6: 60,953,077 (GRCm39) E453K probably damaging Het
Muc5b T A 7: 141,417,875 (GRCm39) V3607E probably benign Het
Myo15a T A 11: 60,417,434 (GRCm39) I3461N Het
Ngef G A 1: 87,405,376 (GRCm39) S678F probably damaging Het
Npc1l1 A T 11: 6,178,157 (GRCm39) S418T probably benign Het
Nprl2 A G 9: 107,421,995 (GRCm39) D257G probably damaging Het
Or4c113 A T 2: 88,885,542 (GRCm39) V76D probably damaging Het
Pard3b A G 1: 62,383,294 (GRCm39) D796G probably benign Het
Pcf11 T C 7: 92,302,451 (GRCm39) T1220A probably benign Het
Ppargc1a A T 5: 51,647,570 (GRCm39) S258T probably damaging Het
Prom1 A G 5: 44,159,135 (GRCm39) Y830H probably damaging Het
Ptprm T A 17: 67,051,732 (GRCm39) H1001L probably damaging Het
Rab8b A G 9: 66,826,807 (GRCm39) F37L probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,229,113 (GRCm39) probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,125 (GRCm39) probably benign Het
Sdk1 A T 5: 142,070,278 (GRCm39) I1148F probably damaging Het
Sec62 A G 3: 30,864,621 (GRCm39) K162E unknown Het
Serpinb13 A T 1: 106,928,519 (GRCm39) I380F probably damaging Het
Sptb T C 12: 76,634,186 (GRCm39) D2175G probably benign Het
St3gal6 T C 16: 58,314,095 (GRCm39) I13V probably benign Het
Tfpi2 A T 6: 3,967,996 (GRCm39) L48H probably damaging Het
Tmem121b T A 6: 120,469,707 (GRCm39) I337F probably damaging Het
Tpbgl T C 7: 99,275,182 (GRCm39) D225G probably benign Het
Trpa1 A G 1: 14,959,664 (GRCm39) V674A probably benign Het
Trpa1 A G 1: 14,963,563 (GRCm39) L553P probably damaging Het
Tyrp1 T C 4: 80,755,798 (GRCm39) V189A probably damaging Het
Vmn1r19 G T 6: 57,381,991 (GRCm39) M181I probably benign Het
Vmn2r10 T C 5: 109,149,791 (GRCm39) T418A probably benign Het
Zfp617 A G 8: 72,686,927 (GRCm39) Y419C probably damaging Het
Other mutations in Pkhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pkhd1 APN 1 20,637,098 (GRCm39) critical splice acceptor site probably null
IGL00687:Pkhd1 APN 1 20,594,294 (GRCm39) missense probably benign 0.19
IGL00824:Pkhd1 APN 1 20,151,408 (GRCm39) critical splice donor site probably null
IGL00870:Pkhd1 APN 1 20,641,614 (GRCm39) missense probably damaging 1.00
IGL00911:Pkhd1 APN 1 20,187,971 (GRCm39) missense probably benign 0.00
IGL01015:Pkhd1 APN 1 20,593,482 (GRCm39) missense possibly damaging 0.95
IGL01025:Pkhd1 APN 1 20,279,400 (GRCm39) missense probably benign 0.04
IGL01064:Pkhd1 APN 1 20,604,754 (GRCm39) splice site probably benign
IGL01313:Pkhd1 APN 1 20,271,248 (GRCm39) missense probably damaging 1.00
IGL01340:Pkhd1 APN 1 20,593,201 (GRCm39) missense probably benign 0.01
IGL01352:Pkhd1 APN 1 20,619,939 (GRCm39) missense probably benign 0.34
IGL01456:Pkhd1 APN 1 20,269,683 (GRCm39) missense probably damaging 1.00
IGL01530:Pkhd1 APN 1 20,629,643 (GRCm39) critical splice donor site probably null
IGL01557:Pkhd1 APN 1 20,187,203 (GRCm39) missense possibly damaging 0.59
IGL01655:Pkhd1 APN 1 20,604,857 (GRCm39) nonsense probably null
IGL01790:Pkhd1 APN 1 20,628,895 (GRCm39) missense probably damaging 0.96
IGL01862:Pkhd1 APN 1 20,429,134 (GRCm39) missense probably damaging 1.00
IGL01874:Pkhd1 APN 1 20,173,459 (GRCm39) missense probably benign 0.32
IGL01901:Pkhd1 APN 1 20,290,307 (GRCm39) missense probably benign 0.11
IGL01903:Pkhd1 APN 1 20,268,361 (GRCm39) missense probably damaging 1.00
IGL01981:Pkhd1 APN 1 20,593,791 (GRCm39) missense possibly damaging 0.64
IGL02068:Pkhd1 APN 1 20,592,971 (GRCm39) missense probably damaging 1.00
IGL02083:Pkhd1 APN 1 20,271,451 (GRCm39) missense probably damaging 1.00
IGL02084:Pkhd1 APN 1 20,447,623 (GRCm39) missense probably damaging 1.00
IGL02126:Pkhd1 APN 1 20,187,419 (GRCm39) missense probably damaging 1.00
IGL02136:Pkhd1 APN 1 20,345,839 (GRCm39) missense probably damaging 1.00
IGL02255:Pkhd1 APN 1 20,654,325 (GRCm39) missense probably damaging 1.00
IGL02272:Pkhd1 APN 1 20,279,484 (GRCm39) missense probably damaging 1.00
IGL02308:Pkhd1 APN 1 20,140,600 (GRCm39) critical splice donor site probably null
IGL02364:Pkhd1 APN 1 20,271,007 (GRCm39) missense probably benign
IGL02389:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02394:Pkhd1 APN 1 20,269,710 (GRCm39) missense possibly damaging 0.57
IGL02403:Pkhd1 APN 1 20,632,642 (GRCm39) missense probably benign 0.01
IGL02415:Pkhd1 APN 1 20,484,645 (GRCm39) missense probably damaging 1.00
IGL02415:Pkhd1 APN 1 20,592,983 (GRCm39) missense probably damaging 1.00
IGL02455:Pkhd1 APN 1 20,434,425 (GRCm39) missense probably damaging 1.00
IGL02502:Pkhd1 APN 1 20,462,389 (GRCm39) missense probably damaging 1.00
IGL02511:Pkhd1 APN 1 20,143,731 (GRCm39) missense possibly damaging 0.90
IGL02530:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02532:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02534:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02556:Pkhd1 APN 1 20,380,934 (GRCm39) missense probably damaging 1.00
IGL02570:Pkhd1 APN 1 20,590,480 (GRCm39) missense probably damaging 0.99
IGL02605:Pkhd1 APN 1 20,621,126 (GRCm39) missense possibly damaging 0.66
IGL02641:Pkhd1 APN 1 20,628,976 (GRCm39) missense possibly damaging 0.61
IGL02741:Pkhd1 APN 1 20,290,253 (GRCm39) splice site probably benign
IGL02752:Pkhd1 APN 1 20,623,815 (GRCm39) missense possibly damaging 0.57
IGL02890:Pkhd1 APN 1 20,431,235 (GRCm39) missense probably damaging 1.00
IGL02959:Pkhd1 APN 1 20,678,640 (GRCm39) nonsense probably null
IGL02960:Pkhd1 APN 1 20,447,670 (GRCm39) missense possibly damaging 0.69
IGL02990:Pkhd1 APN 1 20,593,187 (GRCm39) missense possibly damaging 0.52
IGL03037:Pkhd1 APN 1 20,592,923 (GRCm39) missense probably benign 0.06
IGL03082:Pkhd1 APN 1 20,635,857 (GRCm39) missense probably damaging 1.00
IGL03114:Pkhd1 APN 1 20,268,395 (GRCm39) missense probably damaging 0.99
IGL03288:Pkhd1 APN 1 20,271,243 (GRCm39) missense probably benign 0.01
IGL03328:Pkhd1 APN 1 20,151,524 (GRCm39) splice site probably benign
IGL03375:Pkhd1 APN 1 20,187,247 (GRCm39) missense probably damaging 1.00
IGL03380:Pkhd1 APN 1 20,270,894 (GRCm39) missense probably damaging 1.00
0152:Pkhd1 UTSW 1 20,593,118 (GRCm39) missense possibly damaging 0.46
IGL03046:Pkhd1 UTSW 1 20,607,589 (GRCm39) missense possibly damaging 0.81
LCD18:Pkhd1 UTSW 1 20,681,638 (GRCm39) intron probably benign
P0035:Pkhd1 UTSW 1 20,187,571 (GRCm39) missense probably benign 0.00
PIT4260001:Pkhd1 UTSW 1 20,293,130 (GRCm39) missense possibly damaging 0.51
R0063:Pkhd1 UTSW 1 20,282,174 (GRCm39) missense probably benign 0.02
R0063:Pkhd1 UTSW 1 20,282,174 (GRCm39) missense probably benign 0.02
R0071:Pkhd1 UTSW 1 20,271,568 (GRCm39) missense probably benign 0.11
R0071:Pkhd1 UTSW 1 20,271,568 (GRCm39) missense probably benign 0.11
R0094:Pkhd1 UTSW 1 20,279,470 (GRCm39) missense probably damaging 1.00
R0094:Pkhd1 UTSW 1 20,279,470 (GRCm39) missense probably damaging 1.00
R0103:Pkhd1 UTSW 1 20,593,583 (GRCm39) missense probably benign 0.04
R0103:Pkhd1 UTSW 1 20,593,583 (GRCm39) missense probably benign 0.04
R0105:Pkhd1 UTSW 1 20,593,956 (GRCm39) nonsense probably null
R0105:Pkhd1 UTSW 1 20,593,956 (GRCm39) nonsense probably null
R0115:Pkhd1 UTSW 1 20,420,714 (GRCm39) missense probably damaging 1.00
R0193:Pkhd1 UTSW 1 20,429,141 (GRCm39) missense probably damaging 1.00
R0245:Pkhd1 UTSW 1 20,610,624 (GRCm39) missense probably benign 0.03
R0277:Pkhd1 UTSW 1 20,345,762 (GRCm39) missense probably benign 0.04
R0310:Pkhd1 UTSW 1 20,620,046 (GRCm39) splice site probably null
R0323:Pkhd1 UTSW 1 20,345,762 (GRCm39) missense probably benign 0.04
R0395:Pkhd1 UTSW 1 20,451,771 (GRCm39) missense probably benign 0.26
R0412:Pkhd1 UTSW 1 20,188,012 (GRCm39) missense probably damaging 1.00
R0506:Pkhd1 UTSW 1 20,629,693 (GRCm39) missense probably benign 0.00
R0512:Pkhd1 UTSW 1 20,380,738 (GRCm39) splice site probably benign
R0550:Pkhd1 UTSW 1 20,417,447 (GRCm39) missense probably null 1.00
R0584:Pkhd1 UTSW 1 20,309,660 (GRCm39) nonsense probably null
R0586:Pkhd1 UTSW 1 20,594,335 (GRCm39) missense probably benign 0.04
R0598:Pkhd1 UTSW 1 20,271,114 (GRCm39) missense probably damaging 1.00
R0603:Pkhd1 UTSW 1 20,187,397 (GRCm39) missense probably benign 0.05
R0634:Pkhd1 UTSW 1 20,187,698 (GRCm39) missense probably damaging 1.00
R0677:Pkhd1 UTSW 1 20,594,454 (GRCm39) missense probably benign 0.01
R0746:Pkhd1 UTSW 1 20,268,331 (GRCm39) missense probably damaging 1.00
R0781:Pkhd1 UTSW 1 20,187,708 (GRCm39) missense probably benign 0.01
R0840:Pkhd1 UTSW 1 20,420,745 (GRCm39) missense probably damaging 0.98
R0946:Pkhd1 UTSW 1 20,269,605 (GRCm39) missense probably benign 0.10
R1018:Pkhd1 UTSW 1 20,271,483 (GRCm39) missense possibly damaging 0.89
R1028:Pkhd1 UTSW 1 20,187,950 (GRCm39) missense probably damaging 1.00
R1136:Pkhd1 UTSW 1 20,593,053 (GRCm39) missense possibly damaging 0.68
R1178:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1180:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1222:Pkhd1 UTSW 1 20,637,680 (GRCm39) missense probably benign 0.07
R1334:Pkhd1 UTSW 1 20,604,129 (GRCm39) missense possibly damaging 0.81
R1335:Pkhd1 UTSW 1 20,641,629 (GRCm39) missense probably damaging 1.00
R1387:Pkhd1 UTSW 1 20,625,447 (GRCm39) splice site probably benign
R1411:Pkhd1 UTSW 1 20,444,120 (GRCm39) missense probably damaging 1.00
R1443:Pkhd1 UTSW 1 20,604,782 (GRCm39) missense probably damaging 1.00
R1448:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1468:Pkhd1 UTSW 1 20,593,565 (GRCm39) missense probably damaging 1.00
R1468:Pkhd1 UTSW 1 20,593,565 (GRCm39) missense probably damaging 1.00
R1473:Pkhd1 UTSW 1 20,593,207 (GRCm39) missense probably benign 0.00
R1524:Pkhd1 UTSW 1 20,188,004 (GRCm39) missense probably damaging 1.00
R1532:Pkhd1 UTSW 1 20,187,625 (GRCm39) missense probably benign 0.08
R1565:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1572:Pkhd1 UTSW 1 20,417,664 (GRCm39) missense probably benign 0.02
R1583:Pkhd1 UTSW 1 20,188,049 (GRCm39) missense probably benign
R1617:Pkhd1 UTSW 1 20,268,274 (GRCm39) missense possibly damaging 0.95
R1631:Pkhd1 UTSW 1 20,593,121 (GRCm39) missense probably benign 0.06
R1655:Pkhd1 UTSW 1 20,654,353 (GRCm39) missense probably damaging 1.00
R1707:Pkhd1 UTSW 1 20,621,064 (GRCm39) splice site probably benign
R1753:Pkhd1 UTSW 1 20,604,129 (GRCm39) missense possibly damaging 0.81
R1782:Pkhd1 UTSW 1 20,635,935 (GRCm39) missense probably damaging 0.98
R1791:Pkhd1 UTSW 1 20,655,376 (GRCm39) splice site probably benign
R1822:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1823:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1824:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1836:Pkhd1 UTSW 1 20,187,293 (GRCm39) missense probably benign 0.01
R1862:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably benign 0.00
R1863:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably benign 0.00
R1869:Pkhd1 UTSW 1 20,685,491 (GRCm39) critical splice donor site probably null
R1913:Pkhd1 UTSW 1 20,636,980 (GRCm39) critical splice donor site probably null
R1928:Pkhd1 UTSW 1 20,151,524 (GRCm39) splice site probably benign
R1969:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R1970:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R1981:Pkhd1 UTSW 1 20,187,284 (GRCm39) missense probably benign 0.00
R2008:Pkhd1 UTSW 1 20,269,683 (GRCm39) missense probably damaging 0.99
R2034:Pkhd1 UTSW 1 20,270,893 (GRCm39) missense probably damaging 1.00
R2061:Pkhd1 UTSW 1 20,683,036 (GRCm39) missense possibly damaging 0.76
R2062:Pkhd1 UTSW 1 20,271,559 (GRCm39) missense probably damaging 0.97
R2108:Pkhd1 UTSW 1 20,623,798 (GRCm39) nonsense probably null
R2142:Pkhd1 UTSW 1 20,594,119 (GRCm39) missense probably benign 0.00
R2148:Pkhd1 UTSW 1 20,484,444 (GRCm39) critical splice donor site probably null
R2176:Pkhd1 UTSW 1 20,623,741 (GRCm39) missense probably damaging 1.00
R2202:Pkhd1 UTSW 1 20,607,584 (GRCm39) missense probably benign 0.06
R2255:Pkhd1 UTSW 1 20,635,863 (GRCm39) missense probably benign 0.23
R2269:Pkhd1 UTSW 1 20,604,759 (GRCm39) critical splice donor site probably null
R2275:Pkhd1 UTSW 1 20,271,073 (GRCm39) missense possibly damaging 0.95
R2340:Pkhd1 UTSW 1 20,271,079 (GRCm39) missense probably damaging 1.00
R2431:Pkhd1 UTSW 1 20,271,389 (GRCm39) missense possibly damaging 0.63
R2679:Pkhd1 UTSW 1 20,279,406 (GRCm39) missense probably benign 0.03
R2850:Pkhd1 UTSW 1 20,579,300 (GRCm39) missense possibly damaging 0.89
R2851:Pkhd1 UTSW 1 20,128,526 (GRCm39) missense probably benign 0.16
R2853:Pkhd1 UTSW 1 20,128,526 (GRCm39) missense probably benign 0.16
R2984:Pkhd1 UTSW 1 20,293,185 (GRCm39) missense possibly damaging 0.84
R2987:Pkhd1 UTSW 1 20,174,823 (GRCm39) missense possibly damaging 0.87
R3692:Pkhd1 UTSW 1 20,625,353 (GRCm39) missense possibly damaging 0.87
R3721:Pkhd1 UTSW 1 20,655,879 (GRCm39) missense probably benign 0.08
R3746:Pkhd1 UTSW 1 20,128,524 (GRCm39) makesense probably null
R3838:Pkhd1 UTSW 1 20,604,853 (GRCm39) missense possibly damaging 0.66
R3843:Pkhd1 UTSW 1 20,628,947 (GRCm39) missense probably benign 0.00
R3861:Pkhd1 UTSW 1 20,271,151 (GRCm39) missense probably damaging 1.00
R3893:Pkhd1 UTSW 1 20,382,362 (GRCm39) nonsense probably null
R3926:Pkhd1 UTSW 1 20,621,097 (GRCm39) missense probably benign 0.00
R4183:Pkhd1 UTSW 1 20,188,031 (GRCm39) missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20,633,910 (GRCm39) missense probably benign 0.06
R4184:Pkhd1 UTSW 1 20,279,501 (GRCm39) missense probably benign 0.03
R4255:Pkhd1 UTSW 1 20,664,158 (GRCm39) missense probably damaging 0.99
R4275:Pkhd1 UTSW 1 20,128,608 (GRCm39) missense probably benign 0.00
R4342:Pkhd1 UTSW 1 20,128,841 (GRCm39) missense probably benign 0.00
R4386:Pkhd1 UTSW 1 20,484,516 (GRCm39) missense probably benign 0.00
R4402:Pkhd1 UTSW 1 20,309,635 (GRCm39) missense probably damaging 1.00
R4431:Pkhd1 UTSW 1 20,593,538 (GRCm39) missense probably damaging 0.99
R4560:Pkhd1 UTSW 1 20,282,082 (GRCm39) missense probably damaging 1.00
R4561:Pkhd1 UTSW 1 20,604,943 (GRCm39) missense possibly damaging 0.89
R4570:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R4571:Pkhd1 UTSW 1 20,683,633 (GRCm39) missense probably damaging 1.00
R4588:Pkhd1 UTSW 1 20,271,092 (GRCm39) missense probably benign 0.00
R4598:Pkhd1 UTSW 1 20,573,280 (GRCm39) missense probably damaging 1.00
R4651:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R4657:Pkhd1 UTSW 1 20,434,391 (GRCm39) missense possibly damaging 0.89
R4718:Pkhd1 UTSW 1 20,151,452 (GRCm39) missense probably damaging 1.00
R4740:Pkhd1 UTSW 1 20,594,354 (GRCm39) missense probably benign
R4750:Pkhd1 UTSW 1 20,594,336 (GRCm39) missense possibly damaging 0.57
R4816:Pkhd1 UTSW 1 20,269,639 (GRCm39) missense probably damaging 0.99
R4825:Pkhd1 UTSW 1 20,607,625 (GRCm39) missense probably damaging 0.96
R4885:Pkhd1 UTSW 1 20,140,712 (GRCm39) missense possibly damaging 0.55
R4907:Pkhd1 UTSW 1 20,279,450 (GRCm39) missense probably damaging 1.00
R4944:Pkhd1 UTSW 1 20,358,429 (GRCm39) missense probably null 0.01
R5062:Pkhd1 UTSW 1 20,655,935 (GRCm39) missense probably benign 0.00
R5090:Pkhd1 UTSW 1 20,270,981 (GRCm39) missense probably damaging 1.00
R5104:Pkhd1 UTSW 1 20,655,415 (GRCm39) missense probably damaging 1.00
R5187:Pkhd1 UTSW 1 20,279,448 (GRCm39) missense possibly damaging 0.67
R5202:Pkhd1 UTSW 1 20,617,565 (GRCm39) missense probably benign 0.01
R5240:Pkhd1 UTSW 1 20,345,865 (GRCm39) missense probably benign 0.04
R5248:Pkhd1 UTSW 1 20,604,769 (GRCm39) missense probably benign 0.00
R5252:Pkhd1 UTSW 1 20,420,635 (GRCm39) critical splice donor site probably null
R5293:Pkhd1 UTSW 1 20,579,300 (GRCm39) missense possibly damaging 0.89
R5311:Pkhd1 UTSW 1 20,636,094 (GRCm39) missense possibly damaging 0.94
R5317:Pkhd1 UTSW 1 20,520,528 (GRCm39) missense probably damaging 1.00
R5346:Pkhd1 UTSW 1 20,593,658 (GRCm39) missense probably damaging 0.96
R5346:Pkhd1 UTSW 1 20,462,321 (GRCm39) missense probably benign
R5431:Pkhd1 UTSW 1 20,188,060 (GRCm39) missense probably benign 0.25
R5447:Pkhd1 UTSW 1 20,309,609 (GRCm39) missense probably benign 0.00
R5478:Pkhd1 UTSW 1 20,271,380 (GRCm39) missense probably damaging 1.00
R5497:Pkhd1 UTSW 1 20,447,628 (GRCm39) missense possibly damaging 0.94
R5554:Pkhd1 UTSW 1 20,151,476 (GRCm39) missense probably damaging 0.99
R5579:Pkhd1 UTSW 1 20,593,366 (GRCm39) missense probably damaging 0.96
R5614:Pkhd1 UTSW 1 20,143,750 (GRCm39) missense possibly damaging 0.83
R5648:Pkhd1 UTSW 1 20,628,850 (GRCm39) missense probably benign 0.04
R5651:Pkhd1 UTSW 1 20,188,031 (GRCm39) missense probably benign 0.03
R5665:Pkhd1 UTSW 1 20,658,755 (GRCm39) missense probably damaging 1.00
R5681:Pkhd1 UTSW 1 20,617,685 (GRCm39) missense possibly damaging 0.61
R5754:Pkhd1 UTSW 1 20,593,875 (GRCm39) nonsense probably null
R5760:Pkhd1 UTSW 1 20,143,778 (GRCm39) missense probably benign 0.02
R5776:Pkhd1 UTSW 1 20,279,409 (GRCm39) missense possibly damaging 0.62
R5782:Pkhd1 UTSW 1 20,128,824 (GRCm39) missense probably benign
R5810:Pkhd1 UTSW 1 20,270,897 (GRCm39) missense probably benign 0.26
R5814:Pkhd1 UTSW 1 20,269,629 (GRCm39) missense probably damaging 1.00
R5816:Pkhd1 UTSW 1 20,128,902 (GRCm39) missense probably benign 0.03
R5835:Pkhd1 UTSW 1 20,271,307 (GRCm39) missense probably benign 0.01
R5844:Pkhd1 UTSW 1 20,451,685 (GRCm39) missense probably benign 0.00
R5847:Pkhd1 UTSW 1 20,444,960 (GRCm39) nonsense probably null
R5852:Pkhd1 UTSW 1 20,447,632 (GRCm39) missense probably benign 0.22
R5863:Pkhd1 UTSW 1 20,590,434 (GRCm39) missense possibly damaging 0.63
R6213:Pkhd1 UTSW 1 20,593,994 (GRCm39) missense possibly damaging 0.80
R6351:Pkhd1 UTSW 1 20,282,175 (GRCm39) missense probably benign 0.00
R6386:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably damaging 0.96
R6542:Pkhd1 UTSW 1 20,655,927 (GRCm39) missense probably benign 0.02
R6579:Pkhd1 UTSW 1 20,271,047 (GRCm39) missense probably benign 0.01
R6658:Pkhd1 UTSW 1 20,682,929 (GRCm39) missense probably damaging 1.00
R6765:Pkhd1 UTSW 1 20,128,563 (GRCm39) missense probably benign
R6886:Pkhd1 UTSW 1 20,417,504 (GRCm39) missense probably benign 0.01
R6892:Pkhd1 UTSW 1 20,593,739 (GRCm39) missense probably damaging 1.00
R6900:Pkhd1 UTSW 1 20,604,925 (GRCm39) missense probably benign 0.06
R6932:Pkhd1 UTSW 1 20,632,675 (GRCm39) missense probably benign 0.19
R7191:Pkhd1 UTSW 1 20,628,943 (GRCm39) missense probably benign 0.00
R7220:Pkhd1 UTSW 1 20,593,350 (GRCm39) missense possibly damaging 0.89
R7329:Pkhd1 UTSW 1 20,617,743 (GRCm39) missense probably damaging 0.96
R7361:Pkhd1 UTSW 1 20,664,177 (GRCm39) missense probably damaging 1.00
R7381:Pkhd1 UTSW 1 20,271,197 (GRCm39) missense probably damaging 1.00
R7388:Pkhd1 UTSW 1 20,309,528 (GRCm39) missense not run
R7436:Pkhd1 UTSW 1 20,270,925 (GRCm39) missense probably benign
R7473:Pkhd1 UTSW 1 20,619,980 (GRCm39) missense probably damaging 0.99
R7578:Pkhd1 UTSW 1 20,417,585 (GRCm39) missense probably damaging 1.00
R7751:Pkhd1 UTSW 1 20,271,149 (GRCm39) missense probably damaging 1.00
R7755:Pkhd1 UTSW 1 20,617,717 (GRCm39) missense probably damaging 0.98
R7757:Pkhd1 UTSW 1 20,632,639 (GRCm39) missense probably damaging 1.00
R7832:Pkhd1 UTSW 1 20,573,223 (GRCm39) missense probably damaging 1.00
R7834:Pkhd1 UTSW 1 20,382,273 (GRCm39) missense probably benign
R7920:Pkhd1 UTSW 1 20,345,759 (GRCm39) missense probably damaging 1.00
R8014:Pkhd1 UTSW 1 20,579,115 (GRCm39) critical splice donor site probably null
R8034:Pkhd1 UTSW 1 20,451,662 (GRCm39) missense possibly damaging 0.94
R8085:Pkhd1 UTSW 1 20,683,639 (GRCm39) missense probably damaging 1.00
R8087:Pkhd1 UTSW 1 20,593,313 (GRCm39) missense probably damaging 1.00
R8103:Pkhd1 UTSW 1 20,270,981 (GRCm39) missense probably damaging 1.00
R8122:Pkhd1 UTSW 1 20,632,682 (GRCm39) missense probably damaging 1.00
R8273:Pkhd1 UTSW 1 20,607,644 (GRCm39) splice site probably benign
R8485:Pkhd1 UTSW 1 20,593,257 (GRCm39) missense probably damaging 1.00
R8504:Pkhd1 UTSW 1 20,590,432 (GRCm39) missense probably benign 0.10
R8544:Pkhd1 UTSW 1 20,593,199 (GRCm39) missense probably damaging 1.00
R8692:Pkhd1 UTSW 1 20,462,374 (GRCm39) missense probably damaging 1.00
R8787:Pkhd1 UTSW 1 20,358,461 (GRCm39) missense probably damaging 0.99
R8853:Pkhd1 UTSW 1 20,143,679 (GRCm39) critical splice donor site probably null
R8934:Pkhd1 UTSW 1 20,462,234 (GRCm39) critical splice donor site probably null
R8990:Pkhd1 UTSW 1 20,417,529 (GRCm39) missense probably benign 0.00
R8998:Pkhd1 UTSW 1 20,434,425 (GRCm39) missense probably damaging 1.00
R9024:Pkhd1 UTSW 1 20,592,975 (GRCm39) missense probably benign 0.24
R9035:Pkhd1 UTSW 1 20,573,176 (GRCm39) missense probably damaging 1.00
R9092:Pkhd1 UTSW 1 20,632,586 (GRCm39) missense probably benign 0.00
R9238:Pkhd1 UTSW 1 20,604,799 (GRCm39) missense possibly damaging 0.89
R9258:Pkhd1 UTSW 1 20,444,174 (GRCm39) missense probably damaging 0.99
R9262:Pkhd1 UTSW 1 20,618,351 (GRCm39) missense probably benign 0.01
R9297:Pkhd1 UTSW 1 20,293,118 (GRCm39) missense probably benign 0.06
R9452:Pkhd1 UTSW 1 20,682,953 (GRCm39) missense possibly damaging 0.77
R9515:Pkhd1 UTSW 1 20,637,741 (GRCm39) missense probably damaging 1.00
R9540:Pkhd1 UTSW 1 20,269,570 (GRCm39) missense probably benign 0.00
R9542:Pkhd1 UTSW 1 20,188,004 (GRCm39) missense probably damaging 1.00
R9629:Pkhd1 UTSW 1 20,462,437 (GRCm39) missense possibly damaging 0.63
R9644:Pkhd1 UTSW 1 20,617,690 (GRCm39) missense probably benign 0.04
R9739:Pkhd1 UTSW 1 20,420,708 (GRCm39) missense probably damaging 1.00
R9767:Pkhd1 UTSW 1 20,484,636 (GRCm39) missense probably benign
R9781:Pkhd1 UTSW 1 20,187,665 (GRCm39) missense possibly damaging 0.95
R9803:Pkhd1 UTSW 1 20,637,073 (GRCm39) missense probably damaging 1.00
X0012:Pkhd1 UTSW 1 20,444,150 (GRCm39) missense probably damaging 1.00
X0067:Pkhd1 UTSW 1 20,590,450 (GRCm39) missense probably damaging 1.00
Z1176:Pkhd1 UTSW 1 20,593,971 (GRCm39) missense possibly damaging 0.81
Z1177:Pkhd1 UTSW 1 20,593,845 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,380,818 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,188,107 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,621,243 (GRCm39) missense probably benign
Z1177:Pkhd1 UTSW 1 20,594,162 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCATTGCTCTCTCCCAG -3'
(R):5'- TGATTTATGCCCTCCCACAAG -3'

Sequencing Primer
(F):5'- TCTCCCAGCCCTTTTCTAGG -3'
(R):5'- ATGCCCTCCCACAAGCTCTC -3'
Posted On 2021-08-02