Mutagenetix > Incidental Mutation

Incidental Mutation 'R9258:Pkhd1'

701980

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1

Ensembl Gene

ENSMUSG00000043760

Gene Name

polycystic kidney and hepatic disease 1

Synonyms

FPC, tigmin

MMRRC Submission

Accession Numbers

Genbank: NM_153179; MGI: 2155808

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R9258 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20057779-20618064 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20373950 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 2296 (V2296E)

Ref Sequence

ENSEMBL: ENSMUSP00000085794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088448]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000088448
AA Change: V2296E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: V2296E

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Blast:IPT	134	254	1e-45	BLAST
IPT	256	353	1.13e-3	SMART
low complexity region	722	743	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC
Pfam:TIG	936	1005	9.1e-8	PFAM
IPT	1016	1101	1.18e-6	SMART
IPT	1105	1190	1.27e0	SMART
IPT	1193	1290	7.05e-5	SMART
IPT	1384	1467	1.36e1	SMART
IPT	1568	1655	2.4e0	SMART
low complexity region	1881	1892	N/A	INTRINSIC
G8	1928	2049	1.15e-48	SMART
low complexity region	2079	2094	N/A	INTRINSIC
PbH1	2244	2266	7.82e3	SMART
PbH1	2287	2321	2.23e3	SMART
PbH1	2404	2426	7.19e2	SMART
PbH1	2459	2481	2.64e2	SMART
low complexity region	2713	2728	N/A	INTRINSIC
G8	2734	2867	1.73e-43	SMART
Blast:G8	2876	2923	2e-17	BLAST
PbH1	3004	3026	3.98e3	SMART
PbH1	3027	3049	1.27e0	SMART
PbH1	3080	3102	5.92e2	SMART
low complexity region	3178	3187	N/A	INTRINSIC
PbH1	3188	3212	8.08e3	SMART
transmembrane domain	3852	3874	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931428F04Rik	A	G	8: 105,282,143	V414A	probably damaging	Het
Abcb10	T	A	8: 123,982,608	Q69L	probably benign	Het
Abtb2	A	C	2: 103,716,065	Q930P	probably null	Het
Adam18	G	A	8: 24,668,558	T73I	probably benign	Het
Ankrd54	A	T	15: 79,062,796	M1K	probably null	Het
Anks1	T	C	17: 28,058,426	V1106A	probably damaging	Het
Aox2	A	T	1: 58,312,356	I701F	probably damaging	Het
Arfgef3	C	T	10: 18,589,639	R2152H	probably damaging	Het
Arnt2	C	T	7: 84,361,590	G37E	probably damaging	Het
Arpp21	G	A	9: 112,124,888	T581M	probably benign	Het
Arvcf	A	G	16: 18,398,207	N428S	probably damaging	Het
C2cd3	A	G	7: 100,448,819	E1471G		Het
Cadm1	A	G	9: 47,799,432	K211R	probably benign	Het
Cdh6	A	G	15: 13,064,376	S143P	probably damaging	Het
Cep152	G	A	2: 125,579,436	Q1125*	probably null	Het
Cfap54	A	C	10: 92,935,098	S2095A	unknown	Het
Col12a1	T	C	9: 79,706,363	T67A	probably benign	Het
Col6a3	T	C	1: 90,772,981	N3216S	unknown	Het
Cpeb2	T	A	5: 43,234,112	L217Q		Het
Ctbp2	A	T	7: 132,995,292	N119K	probably damaging	Het
Des	G	T	1: 75,363,645	V399L	probably benign	Het
Dnah2	G	T	11: 69,477,253	H1753Q	probably damaging	Het
Dnajc6	T	C	4: 101,618,616	V562A	probably benign	Het
Dusp13	T	C	14: 21,741,087	D99G	probably benign	Het
Ehd3	A	G	17: 73,820,566	I165V	probably benign	Het
Eme2	C	T	17: 24,893,079	V241M	probably damaging	Het
Eml5	A	G	12: 98,844,117	L860P	possibly damaging	Het
Eogt	T	A	6: 97,112,082	K521M	possibly damaging	Het
Epb41l5	T	C	1: 119,578,971	T489A	probably benign	Het
Fmo5	G	T	3: 97,651,486	V421L	probably benign	Het
Gabpa	C	T	16: 84,856,515	P268S	probably benign	Het
Gas2l3	G	T	10: 89,426,453	H136N	probably benign	Het
Gm5592	C	T	7: 41,288,983	A563V	possibly damaging	Het
Gpn3	A	T	5: 122,381,445	D205V	probably benign	Het
H13	T	C	2: 152,681,079	L104S	probably damaging	Het
H2-Q4	T	A	17: 35,380,129	V125E	probably benign	Het
Ifih1	A	G	2: 62,611,898	F374S	probably damaging	Het
Ildr2	A	G	1: 166,303,589	D338G	probably damaging	Het
Kmt2b	A	T	7: 30,582,468	N1162K	probably null	Het
Lmntd1	T	C	6: 145,413,530	D298G	probably damaging	Het
Lrrc32	T	A	7: 98,499,138	V375E	probably benign	Het
Lrrc37a	A	C	11: 103,502,196	I801R	probably benign	Het
Mgam	A	G	6: 40,680,187	E935G	probably benign	Het
Mms22l	A	T	4: 24,588,238	T917S	probably damaging	Het
Myo3a	A	T	2: 22,577,533	E1204D	possibly damaging	Het
Nav3	T	A	10: 109,714,382	E1829V	probably damaging	Het
Nccrp1	C	T	7: 28,546,207	G150D	probably damaging	Het
Nlrp4b	G	T	7: 10,710,160	W12L	probably damaging	Het
Nmb	T	C	7: 80,904,253	T71A	possibly damaging	Het
Ogfod2	T	A	5: 124,112,442	H35Q	probably benign	Het
Ola1	A	T	2: 73,099,388	S290R	probably damaging	Het
Olfr1297	A	T	2: 111,621,984	I30N	possibly damaging	Het
Olfr1499	A	T	19: 13,814,735	L285*	probably null	Het
Olfr390	T	G	11: 73,787,455	N172K	probably benign	Het
Olfr493	T	G	7: 108,346,679	T101P	probably benign	Het
Olfr589	C	A	7: 103,155,202	E182*	probably null	Het
Olfr621-ps1	T	G	7: 103,629,336	Y208S	unknown	Het
Pcsk9	T	C	4: 106,458,850	D132G	possibly damaging	Het
Prl2c5	A	T	13: 13,190,712	I151L	probably damaging	Het
Prl3d3	A	T	13: 27,160,948	D101V	possibly damaging	Het
Prrt1	A	G	17: 34,631,146	Y178C	probably damaging	Het
Rasal1	A	T	5: 120,655,090	I87F	possibly damaging	Het
Rpgrip1l	A	T	8: 91,260,986	Y814*	probably null	Het
Rpl3l	T	G	17: 24,732,473		probably null	Het
Rrbp1	C	A	2: 144,011,241		probably benign	Het
Ryr3	A	G	2: 112,653,019	S4158P	probably damaging	Het
Scube2	G	T	7: 109,799,308	S951Y	probably damaging	Het
Sec14l1	T	C	11: 117,150,176	V396A	probably benign	Het
Sh3gl1	T	A	17: 56,018,911	K173*	probably null	Het
Shank3	A	T	15: 89,504,318	E371V	probably damaging	Het
Slc25a24	A	G	3: 109,159,435	T302A	probably damaging	Het
Slc25a41	A	T	17: 57,041,580	H4Q	probably benign	Het
Slc45a1	A	T	4: 150,638,614	V271D	possibly damaging	Het
Smad6	A	T	9: 64,020,291	L245Q	probably damaging	Het
Smad7	C	A	18: 75,394,246	Q388K	probably damaging	Het
Snx29	G	T	16: 11,714,935	D348Y	possibly damaging	Het
Son	A	T	16: 91,677,682	H2418L	unknown	Het
Sppl3	G	A	5: 115,095,863	V331M	probably damaging	Het
St13	T	G	15: 81,388,368	T92P	probably benign	Het
St3gal4	A	G	9: 35,052,347	W222R	probably damaging	Het
Stk32a	T	A	18: 43,311,934	N264K	probably benign	Het
Stoml3	T	A	3: 53,497,976	I26N	possibly damaging	Het
Taf7	T	C	18: 37,642,968	E182G	probably damaging	Het
Tas2r138	A	G	6: 40,613,195	V39A	probably damaging	Het
Tbc1d12	A	G	19: 38,901,379	S418G	possibly damaging	Het
Tbr1	T	A	2: 61,812,379	C663S	probably benign	Het
Tmc5	A	T	7: 118,623,278	Y67F	probably benign	Het
Tnfsf4	A	C	1: 161,417,243	I168L	probably benign	Het
Trav5-1	T	G	14: 52,622,890	S51A	probably benign	Het
Trmt10c	A	T	16: 56,034,283	C330S	possibly damaging	Het
Trpm1	T	C	7: 64,234,965	M798T	probably benign	Het
Unc13d	AATGCCTCCCATGCC	AATGCCTCCCATGCCTCCCATGCC	11: 116,068,172		probably benign	Het
Unc13d	CATGCC	CATGCCTCCGATGCC	11: 116,068,181		probably benign	Het
Vmn1r199	A	G	13: 22,382,652	T39A	possibly damaging	Het
Vmn1r74	T	A	7: 11,847,072	C100S	possibly damaging	Het
Vmn2r77	T	A	7: 86,803,094	I494K	possibly damaging	Het
Wdr17	G	A	8: 54,659,619	Q816*	probably null	Het

Other mutations in Pkhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Pkhd1	APN	1	20566874	critical splice acceptor site	probably null
IGL00687:Pkhd1	APN	1	20524070	missense	probably benign	0.19
IGL00824:Pkhd1	APN	1	20081184	critical splice donor site	probably null
IGL00870:Pkhd1	APN	1	20571390	missense	probably damaging	1.00
IGL00911:Pkhd1	APN	1	20117747	missense	probably benign	0.00
IGL01015:Pkhd1	APN	1	20523258	missense	possibly damaging	0.95
IGL01025:Pkhd1	APN	1	20209176	missense	probably benign	0.04
IGL01064:Pkhd1	APN	1	20534530	splice site	probably benign
IGL01313:Pkhd1	APN	1	20201024	missense	probably damaging	1.00
IGL01340:Pkhd1	APN	1	20522977	missense	probably benign	0.01
IGL01352:Pkhd1	APN	1	20549715	missense	probably benign	0.34
IGL01456:Pkhd1	APN	1	20199459	missense	probably damaging	1.00
IGL01530:Pkhd1	APN	1	20559419	critical splice donor site	probably null
IGL01557:Pkhd1	APN	1	20116979	missense	possibly damaging	0.59
IGL01655:Pkhd1	APN	1	20534633	nonsense	probably null
IGL01790:Pkhd1	APN	1	20558671	missense	probably damaging	0.96
IGL01862:Pkhd1	APN	1	20358910	missense	probably damaging	1.00
IGL01874:Pkhd1	APN	1	20103235	missense	probably benign	0.32
IGL01901:Pkhd1	APN	1	20220083	missense	probably benign	0.11
IGL01903:Pkhd1	APN	1	20198137	missense	probably damaging	1.00
IGL01981:Pkhd1	APN	1	20523567	missense	possibly damaging	0.64
IGL02068:Pkhd1	APN	1	20522747	missense	probably damaging	1.00
IGL02083:Pkhd1	APN	1	20201227	missense	probably damaging	1.00
IGL02084:Pkhd1	APN	1	20377399	missense	probably damaging	1.00
IGL02126:Pkhd1	APN	1	20117195	missense	probably damaging	1.00
IGL02136:Pkhd1	APN	1	20275615	missense	probably damaging	1.00
IGL02255:Pkhd1	APN	1	20584101	missense	probably damaging	1.00
IGL02272:Pkhd1	APN	1	20209260	missense	probably damaging	1.00
IGL02308:Pkhd1	APN	1	20070376	critical splice donor site	probably null
IGL02364:Pkhd1	APN	1	20200783	missense	probably benign
IGL02389:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02394:Pkhd1	APN	1	20199486	missense	possibly damaging	0.57
IGL02403:Pkhd1	APN	1	20562418	missense	probably benign	0.01
IGL02415:Pkhd1	APN	1	20414421	missense	probably damaging	1.00
IGL02415:Pkhd1	APN	1	20522759	missense	probably damaging	1.00
IGL02455:Pkhd1	APN	1	20364201	missense	probably damaging	1.00
IGL02502:Pkhd1	APN	1	20392165	missense	probably damaging	1.00
IGL02511:Pkhd1	APN	1	20073507	missense	possibly damaging	0.90
IGL02530:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02532:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02534:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02556:Pkhd1	APN	1	20310710	missense	probably damaging	1.00
IGL02570:Pkhd1	APN	1	20520256	missense	probably damaging	0.99
IGL02605:Pkhd1	APN	1	20550902	missense	possibly damaging	0.66
IGL02641:Pkhd1	APN	1	20558752	missense	possibly damaging	0.61
IGL02741:Pkhd1	APN	1	20220029	splice site	probably benign
IGL02752:Pkhd1	APN	1	20553591	missense	possibly damaging	0.57
IGL02890:Pkhd1	APN	1	20361011	missense	probably damaging	1.00
IGL02959:Pkhd1	APN	1	20608416	nonsense	probably null
IGL02960:Pkhd1	APN	1	20377446	missense	possibly damaging	0.69
IGL02990:Pkhd1	APN	1	20522963	missense	possibly damaging	0.52
IGL03037:Pkhd1	APN	1	20522699	missense	probably benign	0.06
IGL03082:Pkhd1	APN	1	20565633	missense	probably damaging	1.00
IGL03114:Pkhd1	APN	1	20198171	missense	probably damaging	0.99
IGL03288:Pkhd1	APN	1	20201019	missense	probably benign	0.01
IGL03328:Pkhd1	APN	1	20081300	splice site	probably benign
IGL03375:Pkhd1	APN	1	20117023	missense	probably damaging	1.00
IGL03380:Pkhd1	APN	1	20200670	missense	probably damaging	1.00
0152:Pkhd1	UTSW	1	20522894	missense	possibly damaging	0.46
IGL03046:Pkhd1	UTSW	1	20537365	missense	possibly damaging	0.81
LCD18:Pkhd1	UTSW	1	20611414	intron	probably benign
P0035:Pkhd1	UTSW	1	20117347	missense	probably benign	0.00
PIT4260001:Pkhd1	UTSW	1	20222906	missense	possibly damaging	0.51
R0063:Pkhd1	UTSW	1	20211950	missense	probably benign	0.02
R0063:Pkhd1	UTSW	1	20211950	missense	probably benign	0.02
R0071:Pkhd1	UTSW	1	20201344	missense	probably benign	0.11
R0071:Pkhd1	UTSW	1	20201344	missense	probably benign	0.11
R0094:Pkhd1	UTSW	1	20209246	missense	probably damaging	1.00
R0094:Pkhd1	UTSW	1	20209246	missense	probably damaging	1.00
R0103:Pkhd1	UTSW	1	20523359	missense	probably benign	0.04
R0103:Pkhd1	UTSW	1	20523359	missense	probably benign	0.04
R0105:Pkhd1	UTSW	1	20523732	nonsense	probably null
R0105:Pkhd1	UTSW	1	20523732	nonsense	probably null
R0115:Pkhd1	UTSW	1	20350490	missense	probably damaging	1.00
R0193:Pkhd1	UTSW	1	20358917	missense	probably damaging	1.00
R0245:Pkhd1	UTSW	1	20540400	missense	probably benign	0.03
R0277:Pkhd1	UTSW	1	20275538	missense	probably benign	0.04
R0310:Pkhd1	UTSW	1	20549822	splice site	probably null
R0323:Pkhd1	UTSW	1	20275538	missense	probably benign	0.04
R0395:Pkhd1	UTSW	1	20381547	missense	probably benign	0.26
R0412:Pkhd1	UTSW	1	20117788	missense	probably damaging	1.00
R0506:Pkhd1	UTSW	1	20559469	missense	probably benign	0.00
R0512:Pkhd1	UTSW	1	20310514	splice site	probably benign
R0550:Pkhd1	UTSW	1	20347223	missense	probably null	1.00
R0584:Pkhd1	UTSW	1	20239436	nonsense	probably null
R0586:Pkhd1	UTSW	1	20524111	missense	probably benign	0.04
R0598:Pkhd1	UTSW	1	20200890	missense	probably damaging	1.00
R0603:Pkhd1	UTSW	1	20117173	missense	probably benign	0.05
R0634:Pkhd1	UTSW	1	20117474	missense	probably damaging	1.00
R0677:Pkhd1	UTSW	1	20524230	missense	probably benign	0.01
R0746:Pkhd1	UTSW	1	20198107	missense	probably damaging	1.00
R0781:Pkhd1	UTSW	1	20117484	missense	probably benign	0.01
R0840:Pkhd1	UTSW	1	20350521	missense	probably damaging	0.98
R0946:Pkhd1	UTSW	1	20199381	missense	probably benign	0.10
R1018:Pkhd1	UTSW	1	20201259	missense	possibly damaging	0.89
R1028:Pkhd1	UTSW	1	20117726	missense	probably damaging	1.00
R1136:Pkhd1	UTSW	1	20522829	missense	possibly damaging	0.68
R1178:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1180:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1222:Pkhd1	UTSW	1	20567456	missense	probably benign	0.07
R1334:Pkhd1	UTSW	1	20533905	missense	possibly damaging	0.81
R1335:Pkhd1	UTSW	1	20571405	missense	probably damaging	1.00
R1387:Pkhd1	UTSW	1	20555223	splice site	probably benign
R1411:Pkhd1	UTSW	1	20373896	missense	probably damaging	1.00
R1443:Pkhd1	UTSW	1	20534558	missense	probably damaging	1.00
R1448:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1468:Pkhd1	UTSW	1	20523341	missense	probably damaging	1.00
R1468:Pkhd1	UTSW	1	20523341	missense	probably damaging	1.00
R1473:Pkhd1	UTSW	1	20522983	missense	probably benign	0.00
R1524:Pkhd1	UTSW	1	20117780	missense	probably damaging	1.00
R1532:Pkhd1	UTSW	1	20117401	missense	probably benign	0.08
R1565:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1572:Pkhd1	UTSW	1	20347440	missense	probably benign	0.02
R1583:Pkhd1	UTSW	1	20117825	missense	probably benign
R1617:Pkhd1	UTSW	1	20198050	missense	possibly damaging	0.95
R1631:Pkhd1	UTSW	1	20522897	missense	probably benign	0.06
R1655:Pkhd1	UTSW	1	20584129	missense	probably damaging	1.00
R1707:Pkhd1	UTSW	1	20550840	splice site	probably benign
R1753:Pkhd1	UTSW	1	20533905	missense	possibly damaging	0.81
R1782:Pkhd1	UTSW	1	20565711	missense	probably damaging	0.98
R1791:Pkhd1	UTSW	1	20585152	splice site	probably benign
R1822:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1823:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1824:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1836:Pkhd1	UTSW	1	20117069	missense	probably benign	0.01
R1862:Pkhd1	UTSW	1	20551020	missense	probably benign	0.00
R1863:Pkhd1	UTSW	1	20551020	missense	probably benign	0.00
R1869:Pkhd1	UTSW	1	20615267	critical splice donor site	probably null
R1913:Pkhd1	UTSW	1	20566756	critical splice donor site	probably null
R1928:Pkhd1	UTSW	1	20081300	splice site	probably benign
R1969:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R1970:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R1981:Pkhd1	UTSW	1	20117060	missense	probably benign	0.00
R2008:Pkhd1	UTSW	1	20199459	missense	probably damaging	0.99
R2034:Pkhd1	UTSW	1	20200669	missense	probably damaging	1.00
R2061:Pkhd1	UTSW	1	20612812	missense	possibly damaging	0.76
R2062:Pkhd1	UTSW	1	20201335	missense	probably damaging	0.97
R2108:Pkhd1	UTSW	1	20553574	nonsense	probably null
R2142:Pkhd1	UTSW	1	20523895	missense	probably benign	0.00
R2148:Pkhd1	UTSW	1	20414220	critical splice donor site	probably null
R2176:Pkhd1	UTSW	1	20553517	missense	probably damaging	1.00
R2202:Pkhd1	UTSW	1	20537360	missense	probably benign	0.06
R2255:Pkhd1	UTSW	1	20565639	missense	probably benign	0.23
R2269:Pkhd1	UTSW	1	20534535	critical splice donor site	probably null
R2275:Pkhd1	UTSW	1	20200849	missense	possibly damaging	0.95
R2340:Pkhd1	UTSW	1	20200855	missense	probably damaging	1.00
R2431:Pkhd1	UTSW	1	20201165	missense	possibly damaging	0.63
R2679:Pkhd1	UTSW	1	20209182	missense	probably benign	0.03
R2850:Pkhd1	UTSW	1	20509076	missense	possibly damaging	0.89
R2851:Pkhd1	UTSW	1	20058302	missense	probably benign	0.16
R2853:Pkhd1	UTSW	1	20058302	missense	probably benign	0.16
R2984:Pkhd1	UTSW	1	20222961	missense	possibly damaging	0.84
R2987:Pkhd1	UTSW	1	20104599	missense	possibly damaging	0.87
R3692:Pkhd1	UTSW	1	20555129	missense	possibly damaging	0.87
R3721:Pkhd1	UTSW	1	20585655	missense	probably benign	0.08
R3746:Pkhd1	UTSW	1	20058300	makesense	probably null
R3838:Pkhd1	UTSW	1	20534629	missense	possibly damaging	0.66
R3843:Pkhd1	UTSW	1	20558723	missense	probably benign	0.00
R3861:Pkhd1	UTSW	1	20200927	missense	probably damaging	1.00
R3893:Pkhd1	UTSW	1	20312138	nonsense	probably null
R3926:Pkhd1	UTSW	1	20550873	missense	probably benign	0.00
R4183:Pkhd1	UTSW	1	20117807	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20209277	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20563686	missense	probably benign	0.06
R4255:Pkhd1	UTSW	1	20593934	missense	probably damaging	0.99
R4275:Pkhd1	UTSW	1	20058384	missense	probably benign	0.00
R4342:Pkhd1	UTSW	1	20058617	missense	probably benign	0.00
R4386:Pkhd1	UTSW	1	20414292	missense	probably benign	0.00
R4402:Pkhd1	UTSW	1	20239411	missense	probably damaging	1.00
R4431:Pkhd1	UTSW	1	20523314	missense	probably damaging	0.99
R4560:Pkhd1	UTSW	1	20211858	missense	probably damaging	1.00
R4561:Pkhd1	UTSW	1	20534719	missense	possibly damaging	0.89
R4570:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R4571:Pkhd1	UTSW	1	20613409	missense	probably damaging	1.00
R4588:Pkhd1	UTSW	1	20200868	missense	probably benign	0.00
R4598:Pkhd1	UTSW	1	20503056	missense	probably damaging	1.00
R4651:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R4657:Pkhd1	UTSW	1	20364167	missense	possibly damaging	0.89
R4718:Pkhd1	UTSW	1	20081228	missense	probably damaging	1.00
R4740:Pkhd1	UTSW	1	20524130	missense	probably benign
R4750:Pkhd1	UTSW	1	20524112	missense	possibly damaging	0.57
R4816:Pkhd1	UTSW	1	20199415	missense	probably damaging	0.99
R4825:Pkhd1	UTSW	1	20537401	missense	probably damaging	0.96
R4885:Pkhd1	UTSW	1	20070488	missense	possibly damaging	0.55
R4907:Pkhd1	UTSW	1	20209226	missense	probably damaging	1.00
R4944:Pkhd1	UTSW	1	20288205	missense	probably null	0.01
R5062:Pkhd1	UTSW	1	20585711	missense	probably benign	0.00
R5090:Pkhd1	UTSW	1	20200757	missense	probably damaging	1.00
R5104:Pkhd1	UTSW	1	20585191	missense	probably damaging	1.00
R5187:Pkhd1	UTSW	1	20209224	missense	possibly damaging	0.67
R5202:Pkhd1	UTSW	1	20547341	missense	probably benign	0.01
R5240:Pkhd1	UTSW	1	20275641	missense	probably benign	0.04
R5248:Pkhd1	UTSW	1	20534545	missense	probably benign	0.00
R5252:Pkhd1	UTSW	1	20350411	critical splice donor site	probably null
R5293:Pkhd1	UTSW	1	20509076	missense	possibly damaging	0.89
R5311:Pkhd1	UTSW	1	20565870	missense	possibly damaging	0.94
R5317:Pkhd1	UTSW	1	20450304	missense	probably damaging	1.00
R5346:Pkhd1	UTSW	1	20392097	missense	probably benign
R5346:Pkhd1	UTSW	1	20523434	missense	probably damaging	0.96
R5431:Pkhd1	UTSW	1	20117836	missense	probably benign	0.25
R5447:Pkhd1	UTSW	1	20239385	missense	probably benign	0.00
R5478:Pkhd1	UTSW	1	20201156	missense	probably damaging	1.00
R5497:Pkhd1	UTSW	1	20377404	missense	possibly damaging	0.94
R5554:Pkhd1	UTSW	1	20081252	missense	probably damaging	0.99
R5579:Pkhd1	UTSW	1	20523142	missense	probably damaging	0.96
R5614:Pkhd1	UTSW	1	20073526	missense	possibly damaging	0.83
R5648:Pkhd1	UTSW	1	20558626	missense	probably benign	0.04
R5651:Pkhd1	UTSW	1	20117807	missense	probably benign	0.03
R5665:Pkhd1	UTSW	1	20588531	missense	probably damaging	1.00
R5681:Pkhd1	UTSW	1	20547461	missense	possibly damaging	0.61
R5754:Pkhd1	UTSW	1	20523651	nonsense	probably null
R5760:Pkhd1	UTSW	1	20073554	missense	probably benign	0.02
R5776:Pkhd1	UTSW	1	20209185	missense	possibly damaging	0.62
R5782:Pkhd1	UTSW	1	20058600	missense	probably benign
R5810:Pkhd1	UTSW	1	20200673	missense	probably benign	0.26
R5814:Pkhd1	UTSW	1	20199405	missense	probably damaging	1.00
R5816:Pkhd1	UTSW	1	20058678	missense	probably benign	0.03
R5835:Pkhd1	UTSW	1	20201083	missense	probably benign	0.01
R5844:Pkhd1	UTSW	1	20381461	missense	probably benign	0.00
R5847:Pkhd1	UTSW	1	20374736	nonsense	probably null
R5852:Pkhd1	UTSW	1	20377408	missense	probably benign	0.22
R5863:Pkhd1	UTSW	1	20520210	missense	possibly damaging	0.63
R6213:Pkhd1	UTSW	1	20523770	missense	possibly damaging	0.80
R6351:Pkhd1	UTSW	1	20211951	missense	probably benign	0.00
R6386:Pkhd1	UTSW	1	20551020	missense	probably damaging	0.96
R6542:Pkhd1	UTSW	1	20585703	missense	probably benign	0.02
R6579:Pkhd1	UTSW	1	20200823	missense	probably benign	0.01
R6658:Pkhd1	UTSW	1	20612705	missense	probably damaging	1.00
R6765:Pkhd1	UTSW	1	20058339	missense	probably benign
R6886:Pkhd1	UTSW	1	20347280	missense	probably benign	0.01
R6892:Pkhd1	UTSW	1	20523515	missense	probably damaging	1.00
R6900:Pkhd1	UTSW	1	20534701	missense	probably benign	0.06
R6932:Pkhd1	UTSW	1	20562451	missense	probably benign	0.19
R7191:Pkhd1	UTSW	1	20558719	missense	probably benign	0.00
R7220:Pkhd1	UTSW	1	20523126	missense	possibly damaging	0.89
R7329:Pkhd1	UTSW	1	20547519	missense	probably damaging	0.96
R7361:Pkhd1	UTSW	1	20593953	missense	probably damaging	1.00
R7381:Pkhd1	UTSW	1	20200973	missense	probably damaging	1.00
R7388:Pkhd1	UTSW	1	20239304	missense	not run
R7436:Pkhd1	UTSW	1	20200701	missense	probably benign
R7473:Pkhd1	UTSW	1	20549756	missense	probably damaging	0.99
R7578:Pkhd1	UTSW	1	20347361	missense	probably damaging	1.00
R7751:Pkhd1	UTSW	1	20200925	missense	probably damaging	1.00
R7755:Pkhd1	UTSW	1	20547493	missense	probably damaging	0.98
R7757:Pkhd1	UTSW	1	20562415	missense	probably damaging	1.00
R7832:Pkhd1	UTSW	1	20502999	missense	probably damaging	1.00
R7834:Pkhd1	UTSW	1	20312049	missense	probably benign
R7920:Pkhd1	UTSW	1	20275535	missense	probably damaging	1.00
R8014:Pkhd1	UTSW	1	20508891	critical splice donor site	probably null
R8034:Pkhd1	UTSW	1	20381438	missense	possibly damaging	0.94
R8085:Pkhd1	UTSW	1	20613415	missense	probably damaging	1.00
R8087:Pkhd1	UTSW	1	20523089	missense	probably damaging	1.00
R8103:Pkhd1	UTSW	1	20200757	missense	probably damaging	1.00
R8122:Pkhd1	UTSW	1	20562458	missense	probably damaging	1.00
R8273:Pkhd1	UTSW	1	20537420	splice site	probably benign
R8485:Pkhd1	UTSW	1	20523033	missense	probably damaging	1.00
R8504:Pkhd1	UTSW	1	20520208	missense	probably benign	0.10
R8544:Pkhd1	UTSW	1	20522975	missense	probably damaging	1.00
R8692:Pkhd1	UTSW	1	20392150	missense	probably damaging	1.00
R8787:Pkhd1	UTSW	1	20288237	missense	probably damaging	0.99
R8853:Pkhd1	UTSW	1	20073455	critical splice donor site	probably null
R8907:Pkhd1	UTSW	1	20117561	missense	possibly damaging	0.88
R8934:Pkhd1	UTSW	1	20392010	critical splice donor site	probably null
R8990:Pkhd1	UTSW	1	20347305	missense	probably benign	0.00
R8998:Pkhd1	UTSW	1	20364201	missense	probably damaging	1.00
R9024:Pkhd1	UTSW	1	20522751	missense	probably benign	0.24
R9035:Pkhd1	UTSW	1	20502952	missense	probably damaging	1.00
R9092:Pkhd1	UTSW	1	20562362	missense	probably benign	0.00
R9238:Pkhd1	UTSW	1	20534575	missense	possibly damaging	0.89
R9262:Pkhd1	UTSW	1	20548127	missense	probably benign	0.01
R9297:Pkhd1	UTSW	1	20222894	missense	probably benign	0.06
R9452:Pkhd1	UTSW	1	20612729	missense	possibly damaging	0.77
R9515:Pkhd1	UTSW	1	20567517	missense	probably damaging	1.00
R9540:Pkhd1	UTSW	1	20199346	missense	probably benign	0.00
R9542:Pkhd1	UTSW	1	20117780	missense	probably damaging	1.00
R9629:Pkhd1	UTSW	1	20392213	missense	possibly damaging	0.63
R9644:Pkhd1	UTSW	1	20547466	missense	probably benign	0.04
R9739:Pkhd1	UTSW	1	20350484	missense	probably damaging	1.00
R9767:Pkhd1	UTSW	1	20414412	missense	probably benign
R9781:Pkhd1	UTSW	1	20117441	missense	possibly damaging	0.95
R9803:Pkhd1	UTSW	1	20566849	missense	probably damaging	1.00
X0012:Pkhd1	UTSW	1	20373926	missense	probably damaging	1.00
X0067:Pkhd1	UTSW	1	20520226	missense	probably damaging	1.00
Z1176:Pkhd1	UTSW	1	20523747	missense	possibly damaging	0.81
Z1177:Pkhd1	UTSW	1	20117883	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20310594	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20523621	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20523938	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20551019	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCCTGTGAACTGCTGGAAG -3'
(R):5'- TGAAGCCTATTCATGCCCC -3'

Sequencing Primer
(F):5'- AAGAGATCCTTGTGTGCTATCAGC -3'
(R):5'- GTTCCCCCAAAGCTGGAATTATGG -3'

Posted On

2022-03-25