Incidental Mutation 'R1352:Evx1'
ID156699
Institutional Source Beutler Lab
Gene Symbol Evx1
Ensembl Gene ENSMUSG00000005503
Gene Nameeven-skipped homeobox 1
SynonymsEvx-1
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R1352 (G1)
Quality Score178
Status Validated
Chromosome6
Chromosomal Location52313498-52318378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52317010 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 388 (S388P)
Ref Sequence ENSEMBL: ENSMUSP00000031787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031787] [ENSMUST00000129243]
Predicted Effect probably damaging
Transcript: ENSMUST00000031787
AA Change: S388P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031787
Gene: ENSMUSG00000005503
AA Change: S388P

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
HOX 183 245 1.07e-26 SMART
low complexity region 289 298 N/A INTRINSIC
low complexity region 334 356 N/A INTRINSIC
low complexity region 362 381 N/A INTRINSIC
low complexity region 393 406 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125305
Predicted Effect probably benign
Transcript: ENSMUST00000129243
SMART Domains Protein: ENSMUSP00000119111
Gene: ENSMUSG00000005503

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 131 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137258
Meta Mutation Damage Score 0.0889 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the even-skipped homeobox family characterized by the presence of a homeodomain closely related to the Drosophila even-skipped (eve) segmentation gene of the pair-rule class. The encoded protein may play an important role as a transcriptional repressor during embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a particular targeted mutation are embryonic lethal. Another heritable cre-generated allele exhibits defects of the interneurons of the ventral spinal cord, and rarely, a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gm5422 A C 10: 31,250,735 noncoding transcript Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Evx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03048:Evx1 UTSW 6 52315754 missense probably benign 0.03
PIT4802001:Evx1 UTSW 6 52314190 nonsense probably null
R3552:Evx1 UTSW 6 52316923 missense probably damaging 0.99
R3880:Evx1 UTSW 6 52313861 missense probably damaging 1.00
R4351:Evx1 UTSW 6 52313861 missense probably damaging 1.00
R4655:Evx1 UTSW 6 52314197 missense probably damaging 1.00
R5356:Evx1 UTSW 6 52316617 missense probably benign 0.03
R5637:Evx1 UTSW 6 52315766 missense possibly damaging 0.46
R5834:Evx1 UTSW 6 52315990 missense probably damaging 1.00
R6186:Evx1 UTSW 6 52314218 critical splice donor site probably null
R6221:Evx1 UTSW 6 52316783 missense probably damaging 0.99
R6390:Evx1 UTSW 6 52315857 missense probably benign 0.01
R7085:Evx1 UTSW 6 52316692 missense possibly damaging 0.70
X0018:Evx1 UTSW 6 52315996 critical splice donor site probably null
Z1177:Evx1 UTSW 6 52316687 missense not run
Predicted Primers PCR Primer
(F):5'- GCCTTCTACACCTACATGATGAGCC -3'
(R):5'- TCCTAAGCAGCCAATGTCGCTTC -3'

Sequencing Primer
(F):5'- TACATGATGAGCCACGCGG -3'
(R):5'- TCCCCTGTGCATCTGAGAAG -3'
Posted On2014-02-11