Mutagenetix > Incidental Mutations

Incidental Mutation 'R3552:Evx1'

353168

Institutional Source

Beutler Lab

Gene Symbol

Evx1

Ensembl Gene

ENSMUSG00000005503

Gene Name

even-skipped homeobox 1

Synonyms

Evx-1

MMRRC Submission

040669-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.479) question?

Stock #

R3552 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

52313498-52318378 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 52316923 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 359 (S359C)

Ref Sequence

ENSEMBL: ENSMUSP00000031787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031787] [ENSMUST00000129243]

AlphaFold

P23683

Predicted Effect

probably damaging
Transcript: ENSMUST00000031787
AA Change: S359C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000031787
Gene: ENSMUSG00000005503
AA Change: S359C

Domain	Start	End	E-Value	Type
low complexity region	58	68	N/A	INTRINSIC
low complexity region	72	82	N/A	INTRINSIC
low complexity region	162	173	N/A	INTRINSIC
HOX	183	245	1.07e-26	SMART
low complexity region	289	298	N/A	INTRINSIC
low complexity region	334	356	N/A	INTRINSIC
low complexity region	362	381	N/A	INTRINSIC
low complexity region	393	406	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125305

Predicted Effect

probably benign
Transcript: ENSMUST00000129243

SMART Domains

Protein: ENSMUSP00000119111
Gene: ENSMUSG00000005503

Domain	Start	End	E-Value	Type
low complexity region	58	68	N/A	INTRINSIC
low complexity region	72	82	N/A	INTRINSIC
low complexity region	131	162	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137258

Meta Mutation Damage Score

0.1034

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the even-skipped homeobox family characterized by the presence of a homeodomain closely related to the Drosophila even-skipped (eve) segmentation gene of the pair-rule class. The encoded protein may play an important role as a transcriptional repressor during embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a particular targeted mutation are embryonic lethal. Another heritable cre-generated allele exhibits defects of the interneurons of the ventral spinal cord, and rarely, a kinked tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	A	G	18: 38,258,365		probably benign	Het
Acaca	T	A	11: 84,261,624	Y866N	probably damaging	Het
Agk	A	G	6: 40,394,681	T371A	probably benign	Het
Akna	T	C	4: 63,398,124	M1V	probably null	Het
Aldh7a1	T	C	18: 56,550,292		probably null	Het
Ankrd26	A	T	6: 118,507,776	L1500H	probably damaging	Het
Atp13a5	T	A	16: 29,310,766	D452V	probably damaging	Het
Bahcc1	C	T	11: 120,276,772	T1333M	possibly damaging	Het
Carmil3	G	T	14: 55,507,402	R1276L	possibly damaging	Het
Ccni	T	C	5: 93,187,761	S173G	probably benign	Het
Chrm2	A	T	6: 36,523,810	I201F	probably damaging	Het
Col16a1	A	G	4: 130,077,041	T618A	probably benign	Het
Dock2	T	C	11: 34,720,960	Y192C	probably benign	Het
Ep400	T	A	5: 110,729,287	E821V	unknown	Het
Esrrg	G	A	1: 188,150,190	V215I	probably benign	Het
Fcrls	A	G	3: 87,259,410	I92T	possibly damaging	Het
Gal3st1	T	A	11: 3,998,110	F106I	possibly damaging	Het
Gm9944	T	C	4: 144,453,043		probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hrc	G	C	7: 45,336,333	E303Q	possibly damaging	Het
Kcnh1	A	G	1: 192,238,766	N118D	probably damaging	Het
Khdrbs1	A	G	4: 129,720,791	I323T	possibly damaging	Het
Klhdc7b	T	C	15: 89,387,521	Y869H	probably benign	Het
Lrrc4c	T	A	2: 97,629,961	W311R	probably damaging	Het
Megf11	A	G	9: 64,695,463	D862G	possibly damaging	Het
Muc5b	A	G	7: 141,861,335	T2673A	possibly damaging	Het
Muc5b	A	G	7: 141,867,705	S4311G	probably benign	Het
Myo15	C	T	11: 60,509,663	A1767V	possibly damaging	Het
Neo1	T	A	9: 58,893,878	K1140M	probably damaging	Het
Oc90	T	C	15: 65,878,801	Q365R	possibly damaging	Het
Olfr1012	T	C	2: 85,759,893	N161S	possibly damaging	Het
Olfr378	T	C	11: 73,425,852	I44V	probably benign	Het
Olfr48	A	C	2: 89,844,343	M210R	possibly damaging	Het
Oplah	C	T	15: 76,302,094	D734N	possibly damaging	Het
Pbx1	G	A	1: 168,158,793	P411L	possibly damaging	Het
Pcdhga6	G	T	18: 37,708,217	R330L	probably benign	Het
Phox2b	C	A	5: 67,097,656	R150L	probably damaging	Het
Plscr2	A	G	9: 92,290,795	E169G	probably damaging	Het
Ptprn2	A	T	12: 116,888,877	Q518L	probably benign	Het
Rbl1	A	T	2: 157,195,585	I214K	probably benign	Het
Ryr1	T	A	7: 29,056,997	Q3464L	probably damaging	Het
Ryr3	T	A	2: 112,751,787	I2854F	probably damaging	Het
Shtn1	T	C	19: 58,975,038	Y615C	probably benign	Het
Sirt5	A	T	13: 43,383,167	N226Y	probably damaging	Het
Slc30a3	G	A	5: 31,095,078		probably benign	Het
Slc5a4b	A	G	10: 76,081,524	V226A	probably damaging	Het
Slf2	C	A	19: 44,934,951	S68*	probably null	Het
Smyd5	G	A	6: 85,442,211	E292K	probably damaging	Het
Spns1	A	G	7: 126,370,371	V512A	possibly damaging	Het
Sry	T	A	Y: 2,663,141	Q173L	unknown	Het
Ssrp1	C	A	2: 85,044,392	Q519K	probably benign	Het
Tgfbr3	T	C	5: 107,139,839	E498G	probably damaging	Het
Tnrc6b	T	G	15: 80,880,247	L650W	probably damaging	Het
Tnxb	A	T	17: 34,718,721	E3861D	probably damaging	Het
Trbc1	G	T	6: 41,539,645		probably benign	Het
Trpm7	T	A	2: 126,826,710		probably benign	Het
Usp39	G	A	6: 72,337,832	T197I	possibly damaging	Het
Vmn1r38	T	C	6: 66,776,493	H213R	possibly damaging	Het
Washc2	A	G	6: 116,220,568	D168G	probably damaging	Het
Washc4	A	G	10: 83,546,856	I45V	probably benign	Het
Zfp352	A	G	4: 90,225,102	E493G	probably benign	Het
Zfp692	C	T	11: 58,309,428	T170I	possibly damaging	Het
Zfp735	C	A	11: 73,711,241	S337*	probably null	Het

Other mutations in Evx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03048:Evx1	UTSW	6	52315754	missense	probably benign	0.03
PIT4802001:Evx1	UTSW	6	52314190	nonsense	probably null
R1352:Evx1	UTSW	6	52317010	missense	probably damaging	1.00
R3880:Evx1	UTSW	6	52313861	missense	probably damaging	1.00
R4351:Evx1	UTSW	6	52313861	missense	probably damaging	1.00
R4655:Evx1	UTSW	6	52314197	missense	probably damaging	1.00
R5356:Evx1	UTSW	6	52316617	missense	probably benign	0.03
R5637:Evx1	UTSW	6	52315766	missense	possibly damaging	0.46
R5834:Evx1	UTSW	6	52315990	missense	probably damaging	1.00
R6186:Evx1	UTSW	6	52314218	critical splice donor site	probably null
R6221:Evx1	UTSW	6	52316783	missense	probably damaging	0.99
R6390:Evx1	UTSW	6	52315857	missense	probably benign	0.01
R7085:Evx1	UTSW	6	52316692	missense	possibly damaging	0.70
R8127:Evx1	UTSW	6	52313917	missense	possibly damaging	0.87
R8907:Evx1	UTSW	6	52316761	missense	probably damaging	1.00
R8910:Evx1	UTSW	6	52316761	missense	probably damaging	1.00
X0018:Evx1	UTSW	6	52315996	critical splice donor site	probably null
Z1177:Evx1	UTSW	6	52316687	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACCTACATGATGAGCCACGC -3'
(R):5'- CCCTGTGCATCTGAGAAGAGAG -3'

Sequencing Primer
(F):5'- TACTACTCGCCCGTGGG -3'
(R):5'- ACGACGTCCATCCTGCAGTC -3'

Posted On

2015-10-21