Mutagenetix > Incidental Mutations

Incidental Mutation 'R1448:Mrpl44'

159001

Institutional Source

Beutler Lab

Gene Symbol

Mrpl44

Ensembl Gene

ENSMUSG00000026248

Gene Name

mitochondrial ribosomal protein L44

Synonyms

1810030E18Rik, 5730593H20Rik

MMRRC Submission

039503-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1448 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79776018-79781445 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79777960 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 94 (N94K)

Ref Sequence

ENSEMBL: ENSMUSP00000027464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027464] [ENSMUST00000143368]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027464
AA Change: N94K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027464
Gene: ENSMUSG00000026248
AA Change: N94K

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
low complexity region	45	60	N/A	INTRINSIC
PDB:4CE4\|H	67	333	1e-160	PDB
SCOP:d1jfza_	72	224	5e-23	SMART
Blast:RIBOc	86	228	2e-90	BLAST
Blast:DSRM	237	288	6e-8	BLAST
SCOP:d1di2a_	237	304	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143368

SMART Domains

Protein: ENSMUSP00000123303
Gene: ENSMUSG00000073643

Domain	Start	End	E-Value	Type
WD40	13	52	4.95e-4	SMART
WD40	56	96	5.5e1	SMART
WD40	103	142	1.19e0	SMART
Blast:WD40	145	182	6e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189176

Meta Mutation Damage Score

0.6829

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.6%
20x: 87.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417H12Rik	T	A	7: 107,624,745		probably benign	Het
A1cf	A	T	19: 31,908,796	N35I	possibly damaging	Het
Abca2	T	C	2: 25,440,530	I1106T	possibly damaging	Het
Abca4	G	A	3: 122,162,928		probably null	Het
Adgrv1	T	C	13: 81,433,513	D4804G	probably benign	Het
Adk	T	A	14: 21,052,640	M1K	probably null	Het
Aff3	T	C	1: 38,191,283	N1006D	probably damaging	Het
Akap12	A	G	10: 4,355,475	T762A	probably benign	Het
Atp12a	T	A	14: 56,385,839	M843K	probably damaging	Het
Bbx	T	A	16: 50,266,270	K169*	probably null	Het
Bicra	A	T	7: 15,988,359	V411E	possibly damaging	Het
Camk1d	A	T	2: 5,362,025	Y126*	probably null	Het
Cel	T	C	2: 28,556,326	Y511C	probably damaging	Het
Celf4	G	T	18: 25,503,083		probably null	Het
Clasp1	A	G	1: 118,508,916	N310S	probably benign	Het
Col6a3	T	C	1: 90,781,855	K1873R	unknown	Het
Cstf1	A	G	2: 172,375,875	D136G	probably damaging	Het
Cwc22	T	A	2: 77,911,555	E470D	probably damaging	Het
Cxcr2	A	T	1: 74,158,368	D7V	probably benign	Het
Cytip	A	G	2: 58,145,180	I168T	probably damaging	Het
D5Ertd579e	A	G	5: 36,602,739	L1359P	probably benign	Het
Ddx25	A	C	9: 35,557,738	V26G	probably benign	Het
Dennd4a	T	A	9: 64,906,045	S1429T	possibly damaging	Het
Dmd	A	G	X: 84,848,700	D2990G	probably damaging	Het
Dopey1	C	A	9: 86,542,732		probably null	Het
Eps8	T	C	6: 137,522,854	Q209R	possibly damaging	Het
Fabp6	T	A	11: 43,596,165	I112F	probably benign	Het
Fam159b	T	C	13: 104,845,962	I151V	probably benign	Het
Fam214a	C	G	9: 75,010,174	S685*	probably null	Het
Fbxw10	T	C	11: 62,847,592	V104A	possibly damaging	Het
Gp1ba	C	T	11: 70,641,427	P673L	probably damaging	Het
Grin3a	T	C	4: 49,702,804	Y894C	probably damaging	Het
Hydin	C	T	8: 110,446,585	H967Y	probably benign	Het
Ip6k3	T	C	17: 27,145,268	K269E	possibly damaging	Het
Jup	T	C	11: 100,383,200	K172E	probably damaging	Het
Katnal1	T	C	5: 148,904,676	D126G	probably benign	Het
Knl1	A	T	2: 119,068,307	K163M	probably damaging	Het
Krt17	C	T	11: 100,257,539	E359K	possibly damaging	Het
Lct	T	A	1: 128,307,822	I483F	probably damaging	Het
Loxl2	G	A	14: 69,693,040	G751D	probably damaging	Het
Ltbp4	G	A	7: 27,306,577	R1559C	possibly damaging	Het
Man2c1	T	A	9: 57,135,219	D183E	probably benign	Het
Med17	T	C	9: 15,275,843		probably null	Het
Mrgpra9	A	C	7: 47,235,813	S34R	probably benign	Het
Nat8f1	A	G	6: 85,910,942	V12A	probably benign	Het
Nr2e3	C	A	9: 59,943,514	G354V	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nup155	T	C	15: 8,112,406	V94A	probably benign	Het
Olfr1497	A	T	19: 13,794,776	Y278*	probably null	Het
Olfr294	A	T	7: 86,616,361	C95S	probably damaging	Het
Olfr502	T	C	7: 108,523,318	I211V	probably benign	Het
Olfr649	C	T	7: 104,189,875	V111I	possibly damaging	Het
Pcdhb10	A	T	18: 37,412,503	I211F	possibly damaging	Het
Phip	A	C	9: 82,915,423	I509S	possibly damaging	Het
Pkhd1	C	T	1: 20,585,157		probably null	Het
Psme4	T	G	11: 30,852,744	L1487R	probably damaging	Het
Ptgdr2	A	G	19: 10,940,493	S125G	probably damaging	Het
Ptpro	A	G	6: 137,441,116	K126E	probably damaging	Het
Rdh16f2	T	A	10: 127,876,925	V264E	probably benign	Het
Ric8b	C	T	10: 84,947,671	A131V	possibly damaging	Het
Rock1	A	T	18: 10,070,233	I1280N	probably damaging	Het
Rprd2	A	G	3: 95,818,576	V59A	possibly damaging	Het
Ruvbl1	T	A	6: 88,467,569	C49S	probably benign	Het
Scn2a	A	G	2: 65,683,845	N291S	probably benign	Het
Serbp1	T	A	6: 67,277,920	H325Q	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slitrk3	G	A	3: 73,050,341	T366I	probably damaging	Het
Spryd3	A	T	15: 102,118,392	H307Q	possibly damaging	Het
Spx	A	T	6: 142,418,513	D100V	probably benign	Het
Surf4	A	G	2: 26,924,464	F142L	probably damaging	Het
Syne2	T	A	12: 76,020,325		probably null	Het
Syne2	T	C	12: 76,052,178	M5278T	possibly damaging	Het
Thap12	T	C	7: 98,716,023	V466A	probably benign	Het
Thap3	T	C	4: 151,983,216	K135R	possibly damaging	Het
Tmem131	G	T	1: 36,827,358	D448E	probably benign	Het
Tmem63b	C	G	17: 45,678,978	R88P	possibly damaging	Het
Trim43a	G	T	9: 88,582,093	C19F	probably damaging	Het
Trp63	C	T	16: 25,889,120	P526L	possibly damaging	Het
Ubqln3	T	C	7: 104,142,790	D31G	probably damaging	Het
Utp14b	C	A	1: 78,665,445	N353K	probably damaging	Het
Vmn1r40	A	G	6: 89,714,576	K125R	probably damaging	Het
Vmn2r1	A	G	3: 64,101,313	Y471C	probably damaging	Het
Vmn2r13	A	G	5: 109,174,135	I232T	probably damaging	Het
Zfp263	A	C	16: 3,746,459	E204D	probably benign	Het
Zfp865	A	T	7: 5,029,279	K88*	probably null	Het

Other mutations in Mrpl44

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Mrpl44	APN	1	79781004	missense	probably benign	0.01
IGL02633:Mrpl44	APN	1	79776145	missense	probably benign	0.02
R0054:Mrpl44	UTSW	1	79779495	missense	probably damaging	1.00
R0054:Mrpl44	UTSW	1	79779495	missense	probably damaging	1.00
R0909:Mrpl44	UTSW	1	79779653	missense	probably benign	0.43
R1180:Mrpl44	UTSW	1	79777960	missense	probably damaging	0.99
R1347:Mrpl44	UTSW	1	79777952	missense	probably damaging	1.00
R1347:Mrpl44	UTSW	1	79777952	missense	probably damaging	1.00
R3689:Mrpl44	UTSW	1	79779649	nonsense	probably null
R3690:Mrpl44	UTSW	1	79779649	nonsense	probably null
R4533:Mrpl44	UTSW	1	79776254	missense	possibly damaging	0.91
R4818:Mrpl44	UTSW	1	79780977	missense	probably benign	0.00
R4893:Mrpl44	UTSW	1	79777865	missense	probably damaging	0.97
R6178:Mrpl44	UTSW	1	79778178	missense	possibly damaging	0.76
X0018:Mrpl44	UTSW	1	79778075	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- AGCAGAGCAGCCTAATGTGATGTG -3'
(R):5'- GGCAAGTCTGGGAATTCGTCTTCG -3'

Sequencing Primer
(F):5'- ACGGACTGCCAGTGGTTATC -3'
(R):5'- CTGGGAATTCGTCTTCGAGAAAC -3'

Posted On

2014-03-14