Incidental Mutation 'R1472:Bmp10'
ID 164990
Institutional Source Beutler Lab
Gene Symbol Bmp10
Ensembl Gene ENSMUSG00000030046
Gene Name bone morphogenetic protein 10
Synonyms
MMRRC Submission 039525-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1472 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 87428994-87437677 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87433797 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 191 (I191V)
Ref Sequence ENSEMBL: ENSMUSP00000032125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032125]
AlphaFold Q9R229
Predicted Effect probably benign
Transcript: ENSMUST00000032125
AA Change: I191V

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032125
Gene: ENSMUSG00000030046
AA Change: I191V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TGFb_propeptide 52 256 8.1e-24 PFAM
TGFB 320 420 6.7e-52 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which binds to the activin receptor-like kinase 1 (ALK1) and plays important roles in cardiovascular development including cardiomyocyte proliferation and regulation of heart size, closure of the ductus arteriosus, angiogenesis and ventricular trabeculation. Homozygous knockout mice for this gene exhibit impaired heart development and embryonic lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice display decreased embryo size, cardiac dysgenesis, defects in early embryonic vascular development, enlarged pericardium, arteriovenous malformations, and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,067,552 (GRCm38) T834M possibly damaging Het
Ak1 T C 2: 32,630,301 (GRCm38) L32P probably damaging Het
Ankrd24 A G 10: 81,634,920 (GRCm38) D61G probably damaging Het
Atp13a2 T C 4: 140,993,802 (GRCm38) S99P probably damaging Het
Atp8a2 T C 14: 59,860,270 (GRCm38) K770E probably benign Het
C2cd6 A T 1: 59,067,785 (GRCm38) S294T possibly damaging Het
C4b T A 17: 34,743,769 (GRCm38) K20* probably null Het
Caps2 C T 10: 112,179,472 (GRCm38) T139I probably benign Het
Cdc25a T C 9: 109,876,089 (GRCm38) S34P probably benign Het
Cenpv T C 11: 62,536,295 (GRCm38) I146V probably benign Het
Cep57 A T 9: 13,821,554 (GRCm38) F32I probably benign Het
Cep85 A G 4: 134,167,400 (GRCm38) W32R probably damaging Het
Cntrl T C 2: 35,169,317 (GRCm38) probably null Het
Cpd A G 11: 76,784,398 (GRCm38) V1299A probably damaging Het
Cpne6 T C 14: 55,514,635 (GRCm38) V283A probably benign Het
Crot A G 5: 8,966,941 (GRCm38) C584R probably damaging Het
Ctsc A C 7: 88,281,462 (GRCm38) H83P possibly damaging Het
Dido1 T C 2: 180,660,720 (GRCm38) N1797S probably benign Het
Dlgap4 C T 2: 156,760,901 (GRCm38) Q148* probably null Het
Dnah3 T C 7: 120,070,958 (GRCm38) D688G probably benign Het
Dnmt1 T C 9: 20,932,176 (GRCm38) E138G probably benign Het
Edc4 T A 8: 105,892,828 (GRCm38) M1396K probably damaging Het
Haao T A 17: 83,838,838 (GRCm38) Q69L probably benign Het
Hsd3b6 A T 3: 98,807,939 (GRCm38) probably null Het
Itpr3 T A 17: 27,114,225 (GRCm38) I1937N probably benign Het
Kcnk15 C A 2: 163,858,207 (GRCm38) T103K probably damaging Het
Kifc3 A G 8: 95,137,913 (GRCm38) probably null Het
Lama3 T A 18: 12,482,045 (GRCm38) F1342Y probably benign Het
Lilra6 A T 7: 3,912,719 (GRCm38) M98K probably damaging Het
Map3k21 T C 8: 125,941,678 (GRCm38) S668P probably benign Het
Mcpt8 T C 14: 56,082,334 (GRCm38) T220A probably benign Het
Mettl13 C T 1: 162,537,167 (GRCm38) V548I possibly damaging Het
Mfsd4b4 A G 10: 39,891,864 (GRCm38) M411T probably benign Het
Mrfap1 A G 5: 36,796,473 (GRCm38) S41P possibly damaging Het
Mroh2b A G 15: 4,948,655 (GRCm38) I1302V probably benign Het
Mrpl45 C T 11: 97,323,855 (GRCm38) R123* probably null Het
Mstn T A 1: 53,061,998 (GRCm38) I78K probably damaging Het
Mtdh T C 15: 34,114,045 (GRCm38) S168P possibly damaging Het
Muc15 G T 2: 110,731,560 (GRCm38) V114F probably damaging Het
Muc6 T C 7: 141,651,879 (GRCm38) E112G probably benign Het
Myocd G T 11: 65,187,504 (GRCm38) H360Q probably benign Het
Naip2 C T 13: 100,161,860 (GRCm38) G556D probably benign Het
Nav3 T C 10: 109,727,941 (GRCm38) E1627G probably damaging Het
Nlrp14 T C 7: 107,182,703 (GRCm38) L369P probably benign Het
Nlrp6 A G 7: 140,923,495 (GRCm38) T505A probably damaging Het
Npbwr1 T C 1: 5,916,681 (GRCm38) S205G probably damaging Het
Nsmaf G A 4: 6,423,448 (GRCm38) R307* probably null Het
Olfr1505 T C 19: 13,919,844 (GRCm38) S275P probably damaging Het
Olfr187 A T 16: 59,036,557 (GRCm38) L60Q probably damaging Het
Parp9 T G 16: 35,953,680 (GRCm38) S341A possibly damaging Het
Pdss2 A G 10: 43,413,537 (GRCm38) N346S probably benign Het
Pikfyve T A 1: 65,224,201 (GRCm38) F503Y probably damaging Het
Polr1e G T 4: 45,028,026 (GRCm38) A290S probably damaging Het
Ppp1r21 A T 17: 88,558,605 (GRCm38) H305L probably damaging Het
Prss47 A G 13: 65,049,289 (GRCm38) L117P probably damaging Het
Psmb2 A G 4: 126,687,032 (GRCm38) Y73C probably damaging Het
Rcn2 C T 9: 56,056,253 (GRCm38) P222L probably benign Het
Rnf144b T C 13: 47,242,885 (GRCm38) Y233H probably damaging Het
Rnf17 T C 14: 56,427,979 (GRCm38) L196P probably damaging Het
Sik2 A G 9: 51,008,811 (GRCm38) I22T probably damaging Het
Sis A G 3: 72,889,027 (GRCm38) V1807A probably benign Het
Slc1a2 T A 2: 102,737,909 (GRCm38) I88N probably damaging Het
Slc22a22 A G 15: 57,247,520 (GRCm38) F437S probably benign Het
Slc39a13 A T 2: 91,068,705 (GRCm38) C20* probably null Het
Sos2 C T 12: 69,585,316 (GRCm38) probably null Het
Sst A G 16: 23,890,698 (GRCm38) V16A probably benign Het
Stab1 C T 14: 31,141,586 (GRCm38) G2073D probably benign Het
Stxbp1 A T 2: 32,794,636 (GRCm38) S594T probably benign Het
Sugct A T 13: 17,452,546 (GRCm38) C241S probably benign Het
Svil T A 18: 5,048,950 (GRCm38) C76S probably benign Het
Tcaf1 A G 6: 42,686,448 (GRCm38) V166A possibly damaging Het
Tmem131 A T 1: 36,816,241 (GRCm38) N801K possibly damaging Het
Tox3 T C 8: 90,254,345 (GRCm38) N277S probably damaging Het
Tril G T 6: 53,818,027 (GRCm38) R737S probably damaging Het
Trpm2 C A 10: 77,966,007 (GRCm38) V75L probably damaging Het
Tshz1 A C 18: 84,013,805 (GRCm38) L826R possibly damaging Het
Ttn C T 2: 76,766,852 (GRCm38) V19906I probably damaging Het
Wnt5a C T 14: 28,518,504 (GRCm38) R184* probably null Het
Wnt5b G A 6: 119,433,481 (GRCm38) R333C probably damaging Het
Zbtb6 T C 2: 37,429,344 (GRCm38) T191A probably benign Het
Zc3h4 A G 7: 16,434,770 (GRCm38) N935D unknown Het
Zc3h7a C T 16: 11,161,026 (GRCm38) R95H probably damaging Het
Zfp110 T C 7: 12,848,541 (GRCm38) V372A possibly damaging Het
Zmym2 C T 14: 56,911,183 (GRCm38) S318L probably benign Het
Other mutations in Bmp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Bmp10 APN 6 87,429,160 (GRCm38) missense possibly damaging 0.87
IGL00946:Bmp10 APN 6 87,434,362 (GRCm38) missense probably damaging 1.00
IGL01483:Bmp10 APN 6 87,433,951 (GRCm38) missense probably damaging 1.00
IGL02132:Bmp10 APN 6 87,434,148 (GRCm38) missense probably benign
R1391:Bmp10 UTSW 6 87,433,758 (GRCm38) missense probably benign 0.00
R1938:Bmp10 UTSW 6 87,433,720 (GRCm38) missense possibly damaging 0.77
R2114:Bmp10 UTSW 6 87,434,459 (GRCm38) missense probably benign 0.10
R2158:Bmp10 UTSW 6 87,434,080 (GRCm38) missense probably benign 0.21
R4922:Bmp10 UTSW 6 87,433,575 (GRCm38) missense probably benign 0.00
R5042:Bmp10 UTSW 6 87,434,057 (GRCm38) missense probably damaging 0.98
R6041:Bmp10 UTSW 6 87,434,320 (GRCm38) missense probably damaging 1.00
R7000:Bmp10 UTSW 6 87,434,193 (GRCm38) missense probably benign 0.02
R7593:Bmp10 UTSW 6 87,433,669 (GRCm38) missense probably damaging 1.00
R8682:Bmp10 UTSW 6 87,433,559 (GRCm38) critical splice acceptor site probably null
R8844:Bmp10 UTSW 6 87,433,699 (GRCm38) missense probably damaging 1.00
R9378:Bmp10 UTSW 6 87,433,702 (GRCm38) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATCCCTCACCATGAAGAGGTCGTC -3'
(R):5'- CCCACTGAAGAAAGCATCTGAGTCC -3'

Sequencing Primer
(F):5'- GGCGTGGACCGTAAAATTAC -3'
(R):5'- GAAAGCATCTGAGTCCAGGTCC -3'
Posted On 2014-03-28