Incidental Mutation 'R1472:Cpd'
ID165020
Institutional Source Beutler Lab
Gene Symbol Cpd
Ensembl Gene ENSMUSG00000020841
Gene Namecarboxypeptidase D
SynonymsD830034L15Rik
MMRRC Submission 039525-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R1472 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location76778424-76847018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76784398 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1299 (V1299A)
Ref Sequence ENSEMBL: ENSMUSP00000021201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021201]
Predicted Effect probably damaging
Transcript: ENSMUST00000021201
AA Change: V1299A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: V1299A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Zn_pept 62 471 1.71e-52 SMART
Zn_pept 502 900 2.11e-66 SMART
Zn_pept 930 1195 1.11e-42 SMART
Pfam:CarboxypepD_reg 1211 1284 3.6e-10 PFAM
transmembrane domain 1297 1319 N/A INTRINSIC
low complexity region 1363 1371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151584
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,067,552 T834M possibly damaging Het
Ak1 T C 2: 32,630,301 L32P probably damaging Het
Ankrd24 A G 10: 81,634,920 D61G probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bmp10 A G 6: 87,433,797 I191V probably benign Het
C2cd6 A T 1: 59,067,785 S294T possibly damaging Het
C4b T A 17: 34,743,769 K20* probably null Het
Caps2 C T 10: 112,179,472 T139I probably benign Het
Cdc25a T C 9: 109,876,089 S34P probably benign Het
Cenpv T C 11: 62,536,295 I146V probably benign Het
Cep57 A T 9: 13,821,554 F32I probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntrl T C 2: 35,169,317 probably null Het
Cpne6 T C 14: 55,514,635 V283A probably benign Het
Crot A G 5: 8,966,941 C584R probably damaging Het
Ctsc A C 7: 88,281,462 H83P possibly damaging Het
Dido1 T C 2: 180,660,720 N1797S probably benign Het
Dlgap4 C T 2: 156,760,901 Q148* probably null Het
Dnah3 T C 7: 120,070,958 D688G probably benign Het
Dnmt1 T C 9: 20,932,176 E138G probably benign Het
Edc4 T A 8: 105,892,828 M1396K probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hsd3b6 A T 3: 98,807,939 probably null Het
Itpr3 T A 17: 27,114,225 I1937N probably benign Het
Kcnk15 C A 2: 163,858,207 T103K probably damaging Het
Kifc3 A G 8: 95,137,913 probably null Het
Lama3 T A 18: 12,482,045 F1342Y probably benign Het
Lilra6 A T 7: 3,912,719 M98K probably damaging Het
Map3k21 T C 8: 125,941,678 S668P probably benign Het
Mcpt8 T C 14: 56,082,334 T220A probably benign Het
Mettl13 C T 1: 162,537,167 V548I possibly damaging Het
Mfsd4b4 A G 10: 39,891,864 M411T probably benign Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mroh2b A G 15: 4,948,655 I1302V probably benign Het
Mrpl45 C T 11: 97,323,855 R123* probably null Het
Mstn T A 1: 53,061,998 I78K probably damaging Het
Mtdh T C 15: 34,114,045 S168P possibly damaging Het
Muc15 G T 2: 110,731,560 V114F probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Myocd G T 11: 65,187,504 H360Q probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nav3 T C 10: 109,727,941 E1627G probably damaging Het
Nlrp14 T C 7: 107,182,703 L369P probably benign Het
Nlrp6 A G 7: 140,923,495 T505A probably damaging Het
Npbwr1 T C 1: 5,916,681 S205G probably damaging Het
Nsmaf G A 4: 6,423,448 R307* probably null Het
Olfr1505 T C 19: 13,919,844 S275P probably damaging Het
Olfr187 A T 16: 59,036,557 L60Q probably damaging Het
Parp9 T G 16: 35,953,680 S341A possibly damaging Het
Pdss2 A G 10: 43,413,537 N346S probably benign Het
Pikfyve T A 1: 65,224,201 F503Y probably damaging Het
Polr1e G T 4: 45,028,026 A290S probably damaging Het
Ppp1r21 A T 17: 88,558,605 H305L probably damaging Het
Prss47 A G 13: 65,049,289 L117P probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rcn2 C T 9: 56,056,253 P222L probably benign Het
Rnf144b T C 13: 47,242,885 Y233H probably damaging Het
Rnf17 T C 14: 56,427,979 L196P probably damaging Het
Sik2 A G 9: 51,008,811 I22T probably damaging Het
Sis A G 3: 72,889,027 V1807A probably benign Het
Slc1a2 T A 2: 102,737,909 I88N probably damaging Het
Slc22a22 A G 15: 57,247,520 F437S probably benign Het
Slc39a13 A T 2: 91,068,705 C20* probably null Het
Sos2 C T 12: 69,585,316 probably null Het
Sst A G 16: 23,890,698 V16A probably benign Het
Stab1 C T 14: 31,141,586 G2073D probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sugct A T 13: 17,452,546 C241S probably benign Het
Svil T A 18: 5,048,950 C76S probably benign Het
Tcaf1 A G 6: 42,686,448 V166A possibly damaging Het
Tmem131 A T 1: 36,816,241 N801K possibly damaging Het
Tox3 T C 8: 90,254,345 N277S probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Tshz1 A C 18: 84,013,805 L826R possibly damaging Het
Ttn C T 2: 76,766,852 V19906I probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Wnt5b G A 6: 119,433,481 R333C probably damaging Het
Zbtb6 T C 2: 37,429,344 T191A probably benign Het
Zc3h4 A G 7: 16,434,770 N935D unknown Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp110 T C 7: 12,848,541 V372A possibly damaging Het
Zmym2 C T 14: 56,911,183 S318L probably benign Het
Other mutations in Cpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Cpd APN 11 76797789 missense probably benign 0.00
IGL00698:Cpd APN 11 76840444 missense possibly damaging 0.82
IGL01025:Cpd APN 11 76795613 missense probably damaging 1.00
IGL01292:Cpd APN 11 76846245 missense possibly damaging 0.80
IGL01571:Cpd APN 11 76782296 missense probably damaging 1.00
IGL01606:Cpd APN 11 76812640 missense probably benign
IGL02283:Cpd APN 11 76840425 missense probably benign 0.19
IGL02895:Cpd APN 11 76785203 missense probably benign 0.06
IGL02965:Cpd APN 11 76790988 splice site probably benign
IGL03116:Cpd APN 11 76811713 missense probably damaging 1.00
IGL03178:Cpd APN 11 76806051 missense probably benign 0.02
PIT4280001:Cpd UTSW 11 76791024 missense probably benign 0.23
PIT4382001:Cpd UTSW 11 76797788 missense probably benign
R0050:Cpd UTSW 11 76792859 missense possibly damaging 0.94
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0320:Cpd UTSW 11 76840447 missense possibly damaging 0.50
R0416:Cpd UTSW 11 76785204 missense probably benign 0.13
R0556:Cpd UTSW 11 76802345 splice site probably benign
R0666:Cpd UTSW 11 76782327 missense probably damaging 1.00
R0668:Cpd UTSW 11 76784398 missense probably damaging 1.00
R1180:Cpd UTSW 11 76801753 missense possibly damaging 0.56
R1518:Cpd UTSW 11 76840386 critical splice donor site probably null
R1617:Cpd UTSW 11 76846669 missense probably damaging 1.00
R1786:Cpd UTSW 11 76792798 missense probably benign 0.00
R1854:Cpd UTSW 11 76786338 missense probably damaging 1.00
R1861:Cpd UTSW 11 76784382 splice site probably benign
R2159:Cpd UTSW 11 76797641 missense probably damaging 0.96
R2205:Cpd UTSW 11 76802244 missense probably damaging 0.99
R2281:Cpd UTSW 11 76797801 missense probably benign 0.00
R2680:Cpd UTSW 11 76790999 missense probably benign
R2928:Cpd UTSW 11 76846374 missense probably benign
R2937:Cpd UTSW 11 76811859 missense probably damaging 1.00
R4133:Cpd UTSW 11 76814818 nonsense probably null
R4241:Cpd UTSW 11 76846785 missense probably benign 0.03
R4369:Cpd UTSW 11 76797711 missense possibly damaging 0.82
R4538:Cpd UTSW 11 76790999 missense probably benign
R4551:Cpd UTSW 11 76811886 missense probably damaging 1.00
R4617:Cpd UTSW 11 76840615 missense probably damaging 1.00
R4732:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4733:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4821:Cpd UTSW 11 76846237 missense probably benign 0.38
R4852:Cpd UTSW 11 76785150 missense probably benign 0.32
R4901:Cpd UTSW 11 76790881 missense probably damaging 1.00
R4988:Cpd UTSW 11 76814830 missense probably damaging 0.98
R4999:Cpd UTSW 11 76846222 critical splice donor site probably null
R5005:Cpd UTSW 11 76813570 missense probably damaging 1.00
R5092:Cpd UTSW 11 76811704 missense possibly damaging 0.75
R5438:Cpd UTSW 11 76791966 missense possibly damaging 0.65
R5524:Cpd UTSW 11 76797901 nonsense probably null
R5677:Cpd UTSW 11 76799825 missense probably benign
R5826:Cpd UTSW 11 76784416 nonsense probably null
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6103:Cpd UTSW 11 76799799 missense probably benign 0.00
R6257:Cpd UTSW 11 76812670 missense probably benign 0.37
R6263:Cpd UTSW 11 76846271 missense probably benign 0.00
R6485:Cpd UTSW 11 76808707 splice site probably null
R6671:Cpd UTSW 11 76795533 missense probably damaging 1.00
R6995:Cpd UTSW 11 76785055 missense probably benign 0.02
R7074:Cpd UTSW 11 76813594 missense probably damaging 1.00
R7192:Cpd UTSW 11 76814841 missense probably damaging 1.00
R7341:Cpd UTSW 11 76846953 missense unknown
R7371:Cpd UTSW 11 76846611 missense probably benign 0.25
R7380:Cpd UTSW 11 76802325 nonsense probably null
R7392:Cpd UTSW 11 76801779 missense probably damaging 1.00
R7410:Cpd UTSW 11 76782308 missense probably damaging 1.00
R7509:Cpd UTSW 11 76797876 missense probably benign 0.17
R7767:Cpd UTSW 11 76813559 missense probably benign 0.03
Z1088:Cpd UTSW 11 76801746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAATGCACTGGGCAGACAC -3'
(R):5'- GCCACTTGGCTTTGCTTTATAAGCAC -3'

Sequencing Primer
(F):5'- CAGACACATATGAGATCTGTGATAAC -3'
(R):5'- catcattcacatgcagtgcc -3'
Posted On2014-03-28