Incidental Mutation 'R1527:Olfr761'
ID166312
Institutional Source Beutler Lab
Gene Symbol Olfr761
Ensembl Gene ENSMUSG00000109376
Gene Nameolfactory receptor 761
SynonymsMOR218-5P, MOR218-6P, MOR218-12, Olfr1552-ps1, GA_x6K02T2PSCP-2403971-2403000, MOR218-6P
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37952051-37953079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37952829 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 65 (H65L)
Ref Sequence ENSEMBL: ENSMUSP00000092917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049620]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049620
AA Change: H65L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092917
Gene: ENSMUSG00000109376
AA Change: H65L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 3.7e-22 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Olfr761
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Olfr761 APN 17 37952851 missense probably damaging 1.00
IGL02104:Olfr761 APN 17 37952291 missense probably damaging 1.00
IGL02431:Olfr761 APN 17 37952522 missense probably benign 0.06
IGL02649:Olfr761 APN 17 37952973 missense probably damaging 1.00
IGL03109:Olfr761 APN 17 37952487 missense probably damaging 1.00
IGL03261:Olfr761 APN 17 37952806 missense possibly damaging 0.76
R0898:Olfr761 UTSW 17 37952236 missense probably benign 0.17
R1373:Olfr761 UTSW 17 37952360 missense probably damaging 1.00
R1664:Olfr761 UTSW 17 37952893 missense probably benign 0.44
R1835:Olfr761 UTSW 17 37952385 missense possibly damaging 0.79
R4124:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4125:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4128:Olfr761 UTSW 17 37952790 missense probably benign 0.16
R4534:Olfr761 UTSW 17 37952722 missense probably benign
R4557:Olfr761 UTSW 17 37952251 missense probably benign 0.10
R4790:Olfr761 UTSW 17 37952742 missense probably damaging 0.99
R4856:Olfr761 UTSW 17 37952071 missense probably benign 0.15
R4886:Olfr761 UTSW 17 37952071 missense probably benign 0.15
R4955:Olfr761 UTSW 17 37952898 missense probably damaging 1.00
R5162:Olfr761 UTSW 17 37952364 missense probably benign 0.00
R6016:Olfr761 UTSW 17 37952076 missense probably benign 0.13
R6282:Olfr761 UTSW 17 37952424 missense possibly damaging 0.80
R7018:Olfr761 UTSW 17 37952502 missense probably damaging 1.00
R7199:Olfr761 UTSW 17 37952157 missense probably damaging 1.00
R7340:Olfr761 UTSW 17 37952522 missense probably benign 0.06
R7360:Olfr761 UTSW 17 37953009 missense probably damaging 1.00
R7464:Olfr761 UTSW 17 37952280 missense probably damaging 1.00
R7974:Olfr761 UTSW 17 37952781 missense probably damaging 1.00
R8719:Olfr761 UTSW 17 37953004 missense probably damaging 0.97
R8738:Olfr761 UTSW 17 37952782 missense possibly damaging 0.79
R8817:Olfr761 UTSW 17 37952382 missense probably damaging 0.99
R8856:Olfr761 UTSW 17 37952200 missense possibly damaging 0.87
X0064:Olfr761 UTSW 17 37952814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAGATACCTCCACTTAGCCAC -3'
(R):5'- GGTTCTCTGACAACCATGAGCTGC -3'

Sequencing Primer
(F):5'- ATGACCTCATAGTGCAGTGG -3'
(R):5'- GCAGATCTTACAGGCTTTGCTC -3'
Posted On2014-04-13