Incidental Mutation 'R1527:Miga1'
Institutional Source Beutler Lab
Gene Symbol Miga1
Ensembl Gene ENSMUSG00000054942
Gene Namemitoguardin 1
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosomal Location152273849-152340407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 152317663 bp
Amino Acid Change Phenylalanine to Leucine at position 250 (F250L)
Ref Sequence ENSEMBL: ENSMUSP00000143238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068243] [ENSMUST00000073089] [ENSMUST00000196265] [ENSMUST00000199334]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068243
AA Change: F250L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068261
Gene: ENSMUSG00000054942
AA Change: F250L

Pfam:DUF2217 26 306 6.3e-74 PFAM
Pfam:DUF2217 298 507 2.8e-115 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000073089
AA Change: F250L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072836
Gene: ENSMUSG00000054942
AA Change: F250L

Pfam:DUF2217 27 571 4.8e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196265
SMART Domains Protein: ENSMUSP00000142667
Gene: ENSMUSG00000054942

Pfam:DUF2217 26 146 1.5e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199334
AA Change: F250L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143238
Gene: ENSMUSG00000054942
AA Change: F250L

Pfam:DUF2217 26 496 1.2e-179 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000199443
AA Change: F17L
Meta Mutation Damage Score 0.1630 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Miga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Miga1 APN 3 152276690 missense probably benign 0.18
IGL01461:Miga1 APN 3 152335297 missense probably damaging 1.00
IGL02962:Miga1 APN 3 152285341 splice site probably benign
R0165:Miga1 UTSW 3 152290843 missense probably damaging 0.99
R0945:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1769:Miga1 UTSW 3 152287554 missense probably damaging 1.00
R1978:Miga1 UTSW 3 152335304 frame shift probably null
R3697:Miga1 UTSW 3 152322436 missense probably damaging 0.99
R4649:Miga1 UTSW 3 152279005 missense probably benign 0.28
R4660:Miga1 UTSW 3 152287518 missense probably damaging 1.00
R4679:Miga1 UTSW 3 152322475 missense probably damaging 1.00
R4815:Miga1 UTSW 3 152290806 missense probably benign 0.00
R5019:Miga1 UTSW 3 152322461 missense possibly damaging 0.86
R5488:Miga1 UTSW 3 152333446 small deletion probably benign
R6107:Miga1 UTSW 3 152335399 missense probably benign 0.03
R6227:Miga1 UTSW 3 152278949 missense probably benign 0.09
R6292:Miga1 UTSW 3 152317719 missense probably benign 0.30
R6438:Miga1 UTSW 3 152322403 missense probably damaging 1.00
R6444:Miga1 UTSW 3 152283831 missense probably damaging 1.00
R6489:Miga1 UTSW 3 152279008 missense probably damaging 0.99
R6564:Miga1 UTSW 3 152285322 missense probably damaging 1.00
R7354:Miga1 UTSW 3 152290500 missense probably damaging 1.00
R7440:Miga1 UTSW 3 152338046 critical splice acceptor site probably null
R7638:Miga1 UTSW 3 152276687 missense probably benign 0.00
R8039:Miga1 UTSW 3 152276756 missense probably benign 0.15
R8154:Miga1 UTSW 3 152320700 unclassified probably benign
R8418:Miga1 UTSW 3 152285317 missense probably damaging 1.00
R8423:Miga1 UTSW 3 152322408 missense probably benign 0.00
R8486:Miga1 UTSW 3 152276753 missense probably damaging 1.00
R8825:Miga1 UTSW 3 152276823 missense probably damaging 1.00
R8893:Miga1 UTSW 3 152276657 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agacctacagcaaataccttttcc -3'
(R):5'- gcagttcttacacatgctaaagtc -3'
Posted On2014-04-13