Mutagenetix > Incidental Mutation

Incidental Mutation 'R1527:Trpm7'

166269

Institutional Source

Beutler Lab

Gene Symbol

Trpm7

Ensembl Gene

ENSMUSG00000027365

Gene Name

transient receptor potential cation channel, subfamily M, member 7

Synonyms

LTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK

MMRRC Submission

039567-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1527 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

126791565-126876230 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 126830162 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 579 (H579Q)

Ref Sequence

ENSEMBL: ENSMUSP00000099513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]

AlphaFold

Q923J1

PDB Structure

CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000028843
AA Change: H579Q

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: H579Q

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
Pfam:Ion_trans	887	1096	3e-8	PFAM
PDB:3E7K\|H	1198	1249	6e-27	PDB
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1545	6e-64	BLAST
Alpha_kinase	1596	1813	3.77e-89	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000103224
AA Change: H579Q

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: H579Q

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
Pfam:Ion_trans	855	1108	1.7e-9	PFAM
Pfam:TRPM_tetra	1194	1249	3.3e-29	PFAM
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1546	2e-64	BLAST
Alpha_kinase	1597	1814	3.77e-89	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132003

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152615

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059E24Rik	C	A	19: 21,598,269	C130F	probably damaging	Het
4933402N03Rik	T	C	7: 131,138,860	D209G	probably benign	Het
Adam7	A	G	14: 68,501,521	V744A	probably benign	Het
Atr	G	T	9: 95,870,043	R571I	possibly damaging	Het
C5ar1	A	G	7: 16,248,193	Y301H	probably damaging	Het
Cacna1d	A	G	14: 30,107,796	I954T	probably damaging	Het
Ccdc157	A	G	11: 4,151,795	F42S	probably damaging	Het
Chd2	A	T	7: 73,490,614	L622*	probably null	Het
Csmd3	T	C	15: 47,948,087	T1203A	probably benign	Het
Cxcl17	A	G	7: 25,402,211	V67A	possibly damaging	Het
Ddx4	T	C	13: 112,622,239	T263A	possibly damaging	Het
Eps8l1	A	G	7: 4,471,394	D288G	probably benign	Het
Fam208a	T	C	14: 27,480,093		probably null	Het
Fbxl4	A	G	4: 22,386,154	K254E	probably benign	Het
Glis1	T	C	4: 107,567,926	S245P	probably damaging	Het
Gm11111	T	C	5: 98,553,528		probably benign	Het
Haus3	A	T	5: 34,154,053	H544Q	probably benign	Het
Hmcn1	A	G	1: 150,773,803	V644A	probably benign	Het
Lmo7	T	C	14: 101,876,828	L2P	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mga	A	G	2: 119,916,597	T410A	probably damaging	Het
Mical3	T	C	6: 121,024,779	D584G	probably damaging	Het
Miga1	A	T	3: 152,317,663	F250L	possibly damaging	Het
Mroh1	A	G	15: 76,452,263	D1553G	probably benign	Het
Myof	T	C	19: 37,924,619	Y1462C	probably damaging	Het
Notch4	T	C	17: 34,565,744	C144R	probably damaging	Het
Obox1	T	C	7: 15,555,325	V55A	probably damaging	Het
Olfr1241	C	T	2: 89,482,532	G201D	probably benign	Het
Olfr761	T	A	17: 37,952,829	H65L	possibly damaging	Het
Olfr822	T	A	10: 130,075,192	S261T	probably damaging	Het
Pclo	T	C	5: 14,679,648		probably benign	Het
Prr14l	C	T	5: 32,827,949	V1401I	possibly damaging	Het
Rad51ap1	T	C	6: 126,928,167		probably null	Het
Rev3l	T	A	10: 39,822,822	V1105D	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sgsm2	A	T	11: 74,853,848	C848*	probably null	Het
Slc39a10	A	T	1: 46,819,262	V625E	probably benign	Het
Spry4	C	T	18: 38,590,577	M44I	probably benign	Het
Stat5b	A	T	11: 100,808,394		probably null	Het
Tas2r126	T	C	6: 42,435,136	I201T	probably benign	Het
Tex44	A	G	1: 86,427,646	T426A	probably benign	Het
Tln2	T	C	9: 67,272,668	D807G	possibly damaging	Het
Tlr9	A	G	9: 106,223,750	N80S	probably benign	Het
Ufd1	T	C	16: 18,814,911	S29P	probably damaging	Het
Ugt2a3	G	T	5: 87,325,598	Q487K	probably damaging	Het
Wdr66	T	C	5: 123,287,345	V789A	probably benign	Het
Zfyve9	A	G	4: 108,695,767		probably null	Het

Other mutations in Trpm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Trpm7	APN	2	126829031	missense	possibly damaging	0.82
IGL01084:Trpm7	APN	2	126846072	critical splice donor site	probably null
IGL01634:Trpm7	APN	2	126826818	missense	probably damaging	1.00
IGL01678:Trpm7	APN	2	126816799	missense	probably damaging	0.99
IGL02005:Trpm7	APN	2	126813184	missense	probably damaging	0.97
IGL02064:Trpm7	APN	2	126797943	missense	probably damaging	1.00
IGL02156:Trpm7	APN	2	126799243	unclassified	probably benign
IGL02172:Trpm7	APN	2	126795328	missense	possibly damaging	0.94
IGL02334:Trpm7	APN	2	126807362	missense	probably benign
IGL02375:Trpm7	APN	2	126825744	missense	probably damaging	1.00
IGL02388:Trpm7	APN	2	126819891	missense	possibly damaging	0.80
IGL02552:Trpm7	APN	2	126840779	missense	probably damaging	1.00
IGL02684:Trpm7	APN	2	126846159	missense	probably damaging	0.99
IGL02901:Trpm7	APN	2	126807287	critical splice donor site	probably null
Accused	UTSW	2	126826737	missense	probably damaging	0.99
Condemned	UTSW	2	126835508	missense	probably damaging	1.00
denounced	UTSW	2	126813021	missense	probably benign	0.00
deposed	UTSW	2	126797498	missense	probably benign	0.01
Summac	UTSW	2	126819963	missense	probably damaging	1.00
Vacated	UTSW	2	126849922	missense	probably damaging	1.00
P0037:Trpm7	UTSW	2	126816757	splice site	probably benign
R0038:Trpm7	UTSW	2	126795468	missense	probably damaging	1.00
R0139:Trpm7	UTSW	2	126812771	missense	probably benign
R0165:Trpm7	UTSW	2	126797513	missense	probably damaging	0.97
R0511:Trpm7	UTSW	2	126826718	nonsense	probably null
R0543:Trpm7	UTSW	2	126848529	missense	probably damaging	1.00
R0784:Trpm7	UTSW	2	126846072	critical splice donor site	probably null
R0844:Trpm7	UTSW	2	126835508	missense	probably damaging	1.00
R0865:Trpm7	UTSW	2	126799239	splice site	probably null
R0919:Trpm7	UTSW	2	126831238	missense	probably damaging	1.00
R0972:Trpm7	UTSW	2	126805049	missense	probably benign
R1109:Trpm7	UTSW	2	126797793	missense	probably benign	0.01
R1118:Trpm7	UTSW	2	126822486	missense	possibly damaging	0.63
R1278:Trpm7	UTSW	2	126825454	nonsense	probably null
R1542:Trpm7	UTSW	2	126822599	nonsense	probably null
R1882:Trpm7	UTSW	2	126812777	missense	probably benign	0.00
R1951:Trpm7	UTSW	2	126831299	missense	probably damaging	1.00
R2011:Trpm7	UTSW	2	126823997	nonsense	probably null
R2012:Trpm7	UTSW	2	126823997	nonsense	probably null
R2026:Trpm7	UTSW	2	126812738	missense	probably benign	0.39
R2067:Trpm7	UTSW	2	126797727	missense	probably damaging	1.00
R2926:Trpm7	UTSW	2	126858409	splice site	probably benign
R3082:Trpm7	UTSW	2	126844422	missense	possibly damaging	0.90
R3552:Trpm7	UTSW	2	126826710	splice site	probably benign
R3607:Trpm7	UTSW	2	126796428	intron	probably benign
R3739:Trpm7	UTSW	2	126851521	missense	probably damaging	1.00
R3943:Trpm7	UTSW	2	126831218	missense	possibly damaging	0.94
R4161:Trpm7	UTSW	2	126816831	missense	probably damaging	1.00
R4176:Trpm7	UTSW	2	126829163	missense	possibly damaging	0.83
R4392:Trpm7	UTSW	2	126795509	splice site	probably null
R4392:Trpm7	UTSW	2	126848538	missense	probably damaging	1.00
R4404:Trpm7	UTSW	2	126833715	missense	probably damaging	0.97
R4574:Trpm7	UTSW	2	126797211	missense	probably benign	0.01
R4714:Trpm7	UTSW	2	126840783	nonsense	probably null
R4807:Trpm7	UTSW	2	126831229	missense	probably benign	0.00
R4815:Trpm7	UTSW	2	126858492	missense	probably damaging	1.00
R4846:Trpm7	UTSW	2	126813185	missense	possibly damaging	0.63
R4972:Trpm7	UTSW	2	126824058	missense	probably damaging	1.00
R5097:Trpm7	UTSW	2	126796336	critical splice donor site	probably null
R5263:Trpm7	UTSW	2	126821217	missense	probably benign	0.34
R5361:Trpm7	UTSW	2	126829241	missense	possibly damaging	0.77
R5377:Trpm7	UTSW	2	126842855	critical splice donor site	probably null
R5574:Trpm7	UTSW	2	126813030	missense	probably benign
R5782:Trpm7	UTSW	2	126797714	missense	probably benign	0.04
R5840:Trpm7	UTSW	2	126822611	nonsense	probably null
R6044:Trpm7	UTSW	2	126814745	missense	probably damaging	1.00
R6178:Trpm7	UTSW	2	126837381	missense	probably damaging	1.00
R6196:Trpm7	UTSW	2	126825639	missense	possibly damaging	0.66
R6457:Trpm7	UTSW	2	126807294	missense	probably benign
R6530:Trpm7	UTSW	2	126812711	missense	probably damaging	1.00
R6764:Trpm7	UTSW	2	126844420	missense	possibly damaging	0.79
R6841:Trpm7	UTSW	2	126813021	missense	probably benign	0.00
R6868:Trpm7	UTSW	2	126837414	missense	probably damaging	1.00
R7250:Trpm7	UTSW	2	126826765	missense	possibly damaging	0.87
R7402:Trpm7	UTSW	2	126799206	missense	probably damaging	1.00
R7451:Trpm7	UTSW	2	126826737	missense	probably damaging	0.99
R7486:Trpm7	UTSW	2	126831195	critical splice donor site	probably null
R7509:Trpm7	UTSW	2	126849922	missense	probably damaging	1.00
R7586:Trpm7	UTSW	2	126810165	missense	probably benign
R7774:Trpm7	UTSW	2	126813238	missense	probably benign	0.09
R7793:Trpm7	UTSW	2	126824075	nonsense	probably null
R7812:Trpm7	UTSW	2	126799316	missense	probably damaging	1.00
R7900:Trpm7	UTSW	2	126797498	missense	probably benign	0.01
R7951:Trpm7	UTSW	2	126813268	missense	possibly damaging	0.94
R7965:Trpm7	UTSW	2	126825694	missense	probably damaging	0.99
R7992:Trpm7	UTSW	2	126825534	missense	probably benign
R8034:Trpm7	UTSW	2	126846199	missense	probably damaging	0.98
R8199:Trpm7	UTSW	2	126849998	missense	probably damaging	1.00
R8304:Trpm7	UTSW	2	126797877	missense	probably damaging	1.00
R8405:Trpm7	UTSW	2	126816835	missense	probably benign	0.26
R8674:Trpm7	UTSW	2	126799166	unclassified	probably benign
R8742:Trpm7	UTSW	2	126825549	missense	probably damaging	1.00
R8754:Trpm7	UTSW	2	126822703	missense	probably damaging	1.00
R8842:Trpm7	UTSW	2	126821211	missense	probably benign	0.05
R8850:Trpm7	UTSW	2	126810180	missense	probably benign	0.00
R8881:Trpm7	UTSW	2	126819963	missense	probably damaging	1.00
R8898:Trpm7	UTSW	2	126822741	missense	possibly damaging	0.92
R9339:Trpm7	UTSW	2	126823986	missense	probably benign	0.04
R9428:Trpm7	UTSW	2	126829220	missense	probably damaging	1.00
R9446:Trpm7	UTSW	2	126830265	critical splice acceptor site	probably null
R9568:Trpm7	UTSW	2	126822590	missense	probably benign	0.02
R9647:Trpm7	UTSW	2	126825642	missense	probably damaging	1.00
R9678:Trpm7	UTSW	2	126844370	missense	probably damaging	1.00
R9746:Trpm7	UTSW	2	126822658	missense	possibly damaging	0.47
X0026:Trpm7	UTSW	2	126829290	missense	probably benign
Z1088:Trpm7	UTSW	2	126797281	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATAATTCTCAagccaggtgtggtg -3'
(R):5'- ACAGCTAGAGactagataggtgcagtca -3'

Sequencing Primer
(F):5'- tggggggtggggtaagg -3'
(R):5'- gtggcagaagcaagttcaag -3'

Posted On

2014-04-13