Incidental Mutation 'R1527:Sgsm2'
ID 166300
Institutional Source Beutler Lab
Gene Symbol Sgsm2
Ensembl Gene ENSMUSG00000038351
Gene Name small G protein signaling modulator 2
Synonyms D630003G22Rik, Rutbc1
MMRRC Submission 039567-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.245) question?
Stock # R1527 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 74740087-74787886 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 74744674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 848 (C848*)
Ref Sequence ENSEMBL: ENSMUSP00000080489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057631] [ENSMUST00000081799]
AlphaFold Q80U12
Predicted Effect probably null
Transcript: ENSMUST00000057631
AA Change: C803*
SMART Domains Protein: ENSMUSP00000050496
Gene: ENSMUSG00000038351
AA Change: C803*

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 453 476 N/A INTRINSIC
TBC 563 965 3.57e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081799
AA Change: C848*
SMART Domains Protein: ENSMUSP00000080489
Gene: ENSMUSG00000038351
AA Change: C848*

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 446 453 N/A INTRINSIC
low complexity region 498 521 N/A INTRINSIC
TBC 608 1010 3.57e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123573
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator with activity towards RAB32 and RAB33B, which are regulators of membrane trafficking. The encoded protein inactivates RAB32 and can bind RAB9A-GTP, a protein required for RAB32 activation. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,575,633 (GRCm39) C130F probably damaging Het
4933402N03Rik T C 7: 130,740,589 (GRCm39) D209G probably benign Het
Adam7 A G 14: 68,738,970 (GRCm39) V744A probably benign Het
Atr G T 9: 95,752,096 (GRCm39) R571I possibly damaging Het
C5ar1 A G 7: 15,982,118 (GRCm39) Y301H probably damaging Het
Cacna1d A G 14: 29,829,753 (GRCm39) I954T probably damaging Het
Ccdc157 A G 11: 4,101,795 (GRCm39) F42S probably damaging Het
Cfap251 T C 5: 123,425,408 (GRCm39) V789A probably benign Het
Chd2 A T 7: 73,140,362 (GRCm39) L622* probably null Het
Csmd3 T C 15: 47,811,483 (GRCm39) T1203A probably benign Het
Cxcl17 A G 7: 25,101,636 (GRCm39) V67A possibly damaging Het
Ddx4 T C 13: 112,758,773 (GRCm39) T263A possibly damaging Het
Eps8l1 A G 7: 4,474,393 (GRCm39) D288G probably benign Het
Fbxl4 A G 4: 22,386,154 (GRCm39) K254E probably benign Het
Glis1 T C 4: 107,425,123 (GRCm39) S245P probably damaging Het
Gm11111 T C 5: 98,701,387 (GRCm39) probably benign Het
Haus3 A T 5: 34,311,397 (GRCm39) H544Q probably benign Het
Hmcn1 A G 1: 150,649,554 (GRCm39) V644A probably benign Het
Lmo7 T C 14: 102,114,264 (GRCm39) L2P probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Mga A G 2: 119,747,078 (GRCm39) T410A probably damaging Het
Mical3 T C 6: 121,001,740 (GRCm39) D584G probably damaging Het
Miga1 A T 3: 152,023,300 (GRCm39) F250L possibly damaging Het
Mroh1 A G 15: 76,336,463 (GRCm39) D1553G probably benign Het
Myof T C 19: 37,913,067 (GRCm39) Y1462C probably damaging Het
Notch4 T C 17: 34,784,718 (GRCm39) C144R probably damaging Het
Obox1 T C 7: 15,289,250 (GRCm39) V55A probably damaging Het
Or14j8 T A 17: 38,263,720 (GRCm39) H65L possibly damaging Het
Or4a69 C T 2: 89,312,876 (GRCm39) G201D probably benign Het
Or6c69c T A 10: 129,911,061 (GRCm39) S261T probably damaging Het
Pclo T C 5: 14,729,662 (GRCm39) probably benign Het
Prr14l C T 5: 32,985,293 (GRCm39) V1401I possibly damaging Het
Rad51ap1 T C 6: 126,905,130 (GRCm39) probably null Het
Rev3l T A 10: 39,698,818 (GRCm39) V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Slc39a10 A T 1: 46,858,422 (GRCm39) V625E probably benign Het
Spry4 C T 18: 38,723,630 (GRCm39) M44I probably benign Het
Stat5b A T 11: 100,699,220 (GRCm39) probably null Het
Tas2r126 T C 6: 42,412,070 (GRCm39) I201T probably benign Het
Tasor T C 14: 27,202,050 (GRCm39) probably null Het
Tex44 A G 1: 86,355,368 (GRCm39) T426A probably benign Het
Tln2 T C 9: 67,179,950 (GRCm39) D807G possibly damaging Het
Tlr9 A G 9: 106,100,949 (GRCm39) N80S probably benign Het
Trpm7 A C 2: 126,672,082 (GRCm39) H579Q probably benign Het
Ufd1 T C 16: 18,633,661 (GRCm39) S29P probably damaging Het
Ugt2a3 G T 5: 87,473,457 (GRCm39) Q487K probably damaging Het
Zfyve9 A G 4: 108,552,964 (GRCm39) probably null Het
Other mutations in Sgsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Sgsm2 APN 11 74,744,697 (GRCm39) missense possibly damaging 0.91
IGL02164:Sgsm2 APN 11 74,756,242 (GRCm39) missense possibly damaging 0.90
IGL02236:Sgsm2 APN 11 74,750,698 (GRCm39) missense probably damaging 1.00
IGL02330:Sgsm2 APN 11 74,749,493 (GRCm39) missense probably benign 0.01
IGL02352:Sgsm2 APN 11 74,782,900 (GRCm39) splice site probably benign
IGL02359:Sgsm2 APN 11 74,782,900 (GRCm39) splice site probably benign
IGL03061:Sgsm2 APN 11 74,741,962 (GRCm39) missense probably damaging 1.00
IGL03180:Sgsm2 APN 11 74,759,401 (GRCm39) critical splice donor site probably null
R0208:Sgsm2 UTSW 11 74,759,067 (GRCm39) missense probably damaging 1.00
R0433:Sgsm2 UTSW 11 74,749,016 (GRCm39) splice site probably null
R0517:Sgsm2 UTSW 11 74,758,477 (GRCm39) missense possibly damaging 0.62
R0755:Sgsm2 UTSW 11 74,756,323 (GRCm39) missense probably damaging 1.00
R1439:Sgsm2 UTSW 11 74,759,964 (GRCm39) missense probably benign 0.34
R1713:Sgsm2 UTSW 11 74,787,652 (GRCm39) missense probably null 0.04
R1962:Sgsm2 UTSW 11 74,782,854 (GRCm39) missense probably damaging 1.00
R2189:Sgsm2 UTSW 11 74,743,908 (GRCm39) missense probably damaging 1.00
R4259:Sgsm2 UTSW 11 74,782,854 (GRCm39) missense probably damaging 1.00
R4261:Sgsm2 UTSW 11 74,782,854 (GRCm39) missense probably damaging 1.00
R4408:Sgsm2 UTSW 11 74,742,592 (GRCm39) missense probably damaging 0.99
R4590:Sgsm2 UTSW 11 74,741,958 (GRCm39) missense probably damaging 1.00
R6137:Sgsm2 UTSW 11 74,741,677 (GRCm39) missense probably damaging 1.00
R6162:Sgsm2 UTSW 11 74,782,847 (GRCm39) missense probably damaging 1.00
R6457:Sgsm2 UTSW 11 74,755,995 (GRCm39) missense possibly damaging 0.77
R6681:Sgsm2 UTSW 11 74,756,204 (GRCm39) missense probably damaging 0.99
R6722:Sgsm2 UTSW 11 74,756,250 (GRCm39) missense probably damaging 1.00
R6986:Sgsm2 UTSW 11 74,782,867 (GRCm39) missense probably damaging 1.00
R7205:Sgsm2 UTSW 11 74,745,319 (GRCm39) missense possibly damaging 0.88
R7209:Sgsm2 UTSW 11 74,745,151 (GRCm39) missense probably damaging 0.98
R7655:Sgsm2 UTSW 11 74,756,323 (GRCm39) missense probably damaging 1.00
R7656:Sgsm2 UTSW 11 74,756,323 (GRCm39) missense probably damaging 1.00
R8526:Sgsm2 UTSW 11 74,759,847 (GRCm39) missense probably benign 0.17
R9112:Sgsm2 UTSW 11 74,756,222 (GRCm39) nonsense probably null
R9184:Sgsm2 UTSW 11 74,782,834 (GRCm39) missense possibly damaging 0.63
R9226:Sgsm2 UTSW 11 74,748,960 (GRCm39) missense possibly damaging 0.72
R9391:Sgsm2 UTSW 11 74,744,630 (GRCm39) missense probably damaging 1.00
R9458:Sgsm2 UTSW 11 74,759,557 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AGGCCACCACCATCTGATGTGAAG -3'
(R):5'- TGACACACTCAATCTGGGGACTGAC -3'

Sequencing Primer
(F):5'- CCATCTGATGTGAAGGGCAG -3'
(R):5'- TGTGTCTGTCCTGAAAGAGC -3'
Posted On 2014-04-13